C2‐lacking isoform of Nedd4‐2 regulates excitatory synaptic strength through GluA1 ubiquitination‐independent mechanisms

Abstract

Neural precursor cell expressed developmentally downregulated gene 4-like (Nedd4-2) is an epilepsy-associated gene, which encodes a ubiquitin E3 ligase that is highly expressed in the brain. Nedd4-2's substrates include many ion channels and receptors because its N-terminal C2 domain guides Nedd4-2 to the cell membrane. We previously found that Nedd4-2 ubiquitinates the glutamate receptor subunit 1 (GluA1) subunit of the a-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor, which leads to reduction of neuronal excitability and seizures in mice. However, despite awareness of a Nedd4-2 isoform with no C2 domain, the functions of this isoform remain elusive. In this study, we showed that the C2-lacking Nedd4-2 has reduced membrane distribution and exhibits reduced affinity toward ubiquitinating GluA1. However, when expressed in primary cortical neurons, we found that the C2-lacking Nedd4-2 exhibits a similar activity toward reducing excitatory synaptic strength as does the C2containing Nedd4-2. In an attempt to identify novel Nedd4-2 substrates that could mediate excitatory synaptic strength, we used unbiased proteomic screening and found multiple synaptic regulators that were up-regulated in the brain of conditional Nedd4-2 knockout mice, including protein phosphatase 3 catalytic subunit-a (PPP3CA; alternately called calcineurin A-a). We confirmed PPP3CA as a substrate of the C2-lacking Nedd4-2 and showed that all three epilepsyassociated missense mutations of Nedd4-2 disrupted PPP3CA ubiquitination. Altogether, our results revealed novel potential Nedd4-2 substrates and suggest that the C2-lacking Nedd4-2 represses excitatory synaptic strength most likely through GluA1 ubiquitination-independent mechanisms. These findings provide novel information to further our knowledge about Nedd4-2-dependent neuronal excitability homeostasis and pathological hyperexcitability when Nedd4-2 is compromised.

Unbiased proteomic screening identifies a novel role for the E3 ubiquitin ligase Nedd4‐2 in translational suppression during ER stress

“…To this end, we obtained total membrane fractions, using Mem‐PER Plus Membrane Protein Extraction reagents from whole brains of Nedd4‐2 WT ( Nedd4‐2 f/f Emx1 ‐ Cre − ) and Nedd4‐2 cKO ( Nedd4‐2 f/f Emx1 ‐ Cre + ) mice for quantitative proteomic profiling. We focused on membrane fractions because Nedd4‐2 is known to interact with and ubiquitinate membrane‐bound proteins (Zhu et al., 2019). The Emx1 ‐ Cre allows for a reduction of Nedd4‐2 in the cortex and hippocampus beginning at embryonic day 10.5 (Gorski et al., 2002), and western blotting shows an 80% reduction of Nedd4‐2 in the whole brain (Figure 1a).…”

“…No randomization was performed to allocate subjects in this study. Although sample‐size calculations were not performed, at least three independent litters were used in each experiment as established by previous work in our lab (Zhu et al., 2019). For experiments utilizing cortical neuron cultures, each experiment was performed and analyzed using sister cultures made from the same litter.…”

“…These mice were anesthetized by isofluorane inhalation and then decapitated. Genotyping was performed for both the Nedd4‐2 loxP allele and the Emx1‐Cre using PCR as described previously (Zhu et al., 2019). The primers used to detect the Ribotag allele were: 5′‐GGGAGGCTTGCTGGATATG‐3′ and 5′‐TTTCCAGACACAGGCTAAGTACAC‐3′.…”

“…The proteomic screening was conducted using total membrane fractions of Nedd4‐2 WT ( Nedd4‐2 f/f Cre − ) and Nedd4‐2 conditional knockout (KO) ( Nedd4‐2 f/f Cre + ) mouse brains with label‐free analyses provided by Bioproximity. The membrane protein extraction assay was conducted by the Mem‐PER Plus Membrane Protein Extraction Kit (Thermo Scientific; catalog: 89842) and was done according to the manufacturer's protocols with minor modifications as described previously (Zhu et al., 2019). Following membrane extraction, trypsin was added at a ratio of 1:50 to the samples, which were then incubated at 37°C overnight.…”

“…We focused on membrane fractions because Nedd4-2 is known to interact with and ubiquitinate membrane-bound proteins (Zhu et al, 2019). The Emx1-Cre allows for a reduction of Nedd4-2 in the cortex and hippocampus beginning at embryonic day 10.5 (Gorski et al, 2002), and western blotting shows an 80% reduction of Nedd4-2 in the whole brain (Figure 1a).…”