Campylobacter fetus em bovinos no estado do Rio Grande do Sul

Ziech, Rosângela Estel; Machado, Gustavo; Kirinus, Jackeline Karsten; Libardoni, Felipe; Kessler, Julcemar Dias; Pötter, Luciana; Vargas, Agueda Castagna de

doi:10.1590/s0103-84782014000100023

Cited by 7 publications

(7 citation statements)

References 11 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The cows in this study were not pregnant, but it was not possible to identify the stage of the estrous cycle due to the lack of record in zootechnical records by the owners. The number of microorganisms in the vaginal mucus and the amount of secretion obtained are higher during estrus, which may decrease the sensitivity of diagnostic tests for carrier females, since not all collected females are in this condition [24,25], which probably occurred in this study, and may have influenced the detection of the agent DNA, and consequently the prevalence may be higher than that found. Therefore, it is recommended to collect from females in the estrus period and to use estrus synchronization when the objective is to obtain representative sampling of the herd [25], since a larger number of cows will be in heat at the same time during a visit to the farm.…”

Section: Discussionmentioning

confidence: 65%

“…The number of microorganisms in the vaginal mucus and the amount of secretion obtained are higher during estrus, which may decrease the sensitivity of diagnostic tests for carrier females, since not all collected females are in this condition [24,25], which probably occurred in this study, and may have influenced the detection of the agent DNA, and consequently the prevalence may be higher than that found. Therefore, it is recommended to collect from females in the estrus period and to use estrus synchronization when the objective is to obtain representative sampling of the herd [25], since a larger number of cows will be in heat at the same time during a visit to the farm. However, the use of drugs for synchronization only for collection, when the rural producer does not yet use this tool as a reproductive strategy, increases costs for the owner in the case of routine diagnosis or for the researcher when performing epidemiological surveys like this one.…”

Section: Discussionmentioning

confidence: 65%

See 1 more Smart Citation

Prevalence of Campylobacter fetus subsp. venerealis in Dairy Cows from Brejo Paraibano, Brazil

Filho

Malta

Lúcio

et al. 2018

Acta Scientiae. Vet.

View full text Add to dashboard Cite

Background: Bovine genital campylobacteriosis (BGC) results in an increase in the interval between calving, increase in age at first calving, increase in the number of doses of semen or services by conception, and reduction in the number of animals born and weaned. Due to the importance of cattle breeding in Brazil, to the impact of BGC on bovine reproductive health, and since campylobacteriosis has never been studied in this region of Brazil, epidemiological studies on C. fetus infection in bovine herds are essential. The objective of this study was to determine prevalence of Campylobacter fetus subsp. venerealis infection in dairy cows from the Brejo Paraibano region, northeastern Brazil.Materials, Methods & Results: A cross-sectional study was conducted to determine prevalence of animals infected by C. fetus subsp. venerealis. In order to compose the sample of the number of farms, a total of 30 farming establishments with milk cattle and expected prevalence of 1.8%, 95% confidence interval (CI) and statistical error of 5% were considered, which provided a minimum of 15 farms. Samples of cervico-vaginal mucus were collected from 273 dairy cows from 19 farms. Polymerase chain reaction was used for laboratory diagnosis using the oligonucleotides VENSF1 (5’CTTAGCAGTTTGCGATATTGCCATT3’) and VENS2 (5’GCTTTTGAGATAACAATAAGAGCTT3’) for detection of a 142 base-pairs product. In order to confirm the results, positive samples were purified after amplification and bidirectional sequenced. A thematic map was prepared with prevalence distributions in the studied area. The prevalence of C. fetus subsp. venerealis infection in cows was 7.7% (confidence interval [CI] 95%, 4.8%-11.5%), and 31.6% (6/19) of the farms showed at least one positive animal. Of the six counties surveyed, all (100.0%) had positive animals, with a positive farm per county. Regarding age, it was observed that all positive animals were between two and 15 years old, with a mean age of 6.2 years.Discussion: This is the first report of C. fetus subsp. venerealis infection in dairy cows in this region of Brazil. In this microregion, 7.7% (21) were positive in the PCR. Considering only the samples of females, in Brazil a result close to that of the present study was obtained in the Federal District and Goiás, where a prevalence of 10.5% (27/258) was determined using direct immunofluorescence (DIF) in samples of uterine and vaginal swabs from animals slaughtered in slaughter houses. However, the prevalence observed in the present study was lower than that generally reported, including in other regions of the country. In Minas Gerais, a prevalence of 25.5% (40/157) was found using DIF in samples of cervical-vaginal mucus from cows from herds with reproductive problems. In the state of Rio Grande do Sul, 13.6% of samples from cows were PCR positive. The use of high sensitivity tests, such as PCR, which can detect a small number of microorganisms, is important in studies of this nature. The prevalence of farms with positive animals, associated with the detection of infection in cattle of all the counties surveyed, makes it possible to affirm that C. fetus subsp. venerealis infection is present in cattle in the Brejo Paraibano microregion. This study demonstrates the presence of C. fetus subsp. venerealis DNA in dairy cows in the surveyed region. It is recommended to adopt an artificial insemination program on the farms, as well as a vaccination program to stimulate immunity in order to reduce the occurrence of infection and possible reproductive problems.

show abstract

Section: Discussionmentioning

confidence: 65%

Section: Discussionmentioning

confidence: 65%

Prevalence of Campylobacter fetus subsp. venerealis in Dairy Cows from Brejo Paraibano, Brazil

Filho

Malta

Lúcio

et al. 2018

Acta Scientiae. Vet.

View full text Add to dashboard Cite

show abstract

“…venerealis. In Brazil, Ziech et al (2014) used PCR to detect C. fetus at the species level. In theory, this might also result in an overestimation of the prevalence of BGC as direct immunofluorescence, because C. fetus subsp.…”

Section: Resultsmentioning

confidence: 99%

Prevalence of Tritrichomonas foetus and Campylobacter fetus subsp. venerealis among bulls slaughtered in the state of Minas Gerais, Brazil

Botelho

Hirsch

Lage

et al. 2018

SCA

View full text Add to dashboard Cite

Bovine genital campylobacteriosis (BGC) and bovine genital trichomonosis (BGT) are globally widespread, predominantly sexually transmitted diseases that mainly affect herds in which natural mating takes place. Bulls serve as good epidemiological indicators for studying the causative agents of these diseases in cattle herds. The objective of the present work was to determine the prevalence of BGC and BGT among bulls sent to slaughterhouses in southern Minas Gerais, Brazil. Samples of preputial smegma from 200 sexually mature, non-castrated bulls of several ancestries were collected in 2013 from four regional slaughterhouses. The polymerase chain reaction (PCR) was employed to detect Tritrichomonas foetus, Campylobacter fetus subsp. fetus, and C. fetus subsp. venerealis. Isolation also was used aiming to diagnosis of BGT. All smegma samples were negative in culture for T. foetus. Molecular tests revealed 8% (16/200) of animals to be positive for T. foetus, 17.5% (35/200) for Campylobacter. fetus subsp. fetus, and 13.5% (27/200) for C. fetus subsp. venerealis. The results of the present study indicate that T. foetus, C. fetus subsp. venerealis, and C. fetus subsp. fetus are present among bulls slaughtered in southern Minas Gerais, and that BGC and BGT occur in this region. These diseases therefore need to be considered during differential diagnosis of reproductive diseases affecting cattle herds in which natural mating is employed.

show abstract

“…Complementary tests significantly impact on greater diagnosis proportion [4]. However, reaching a final diagnosis is still a challenging task, leading to an inconclusive diagnose for the majority of spontaneously abortion cases in ovine and bovine due to incorrect sampling or difficulties in the agent identification and serological testing [2,28]. Thus, investigating the etiologic cause of abortion is recommended for better understanding the causes of pregnancy issues and monitoring their occurrence.…”

Section: Discussionmentioning

confidence: 99%

Campylobacter fetus in Abomasal Fluid from Spontaneously Aborted Bovine and Ovine Fetuses

Breyer

Dias²,

Henker³

et al. 2021

Acta Scientiae. Vet.

View full text Add to dashboard Cite

Background: Pregnancy losses are a major concern in livestock industry due to their economic impact on producers. Campylobacter fetus subspecies fetus (Cff) and C. fetus subspecies venerealis (Cfv) are directly related to reproductive failures in ruminants. Cff colonizes the gastrointestinal tract of a wide range of hosts leading to abortion, while Cfv is restricted to genital tract being generally associated to infertility in bovine. Considering the great economic losses related to campylobacteriosis in cattle and ovine herds, this study aims to investigate the occurrence of C. fetus, considering Cff and Cfv subspecies, in bovine and ovine spontaneously aborted fetuses in state of Rio Grande do Sul, Brazil.Materials, Methods & Results: In this study, samples of abomasal fluid collected from 30 spontaneously aborted bovine (n = 18) and ovine (n = 12) fetuses were investigated for the detection of Campylobacter fetus throughout conventional PCR. Positive fetuses for C. fetus presence were further analyzed by molecular assays for Cff and Cfv detection, in order to determine subspecies identification. When available, samples of the main organs of the thoracic and abdominal cavities, as well as the brain, skeletal muscle, eyelid, skin, and placenta were collected for further histopathological analyses and bacterial culture, aiming to assess the presence of infection lesions and pathogens in those sites, respectively. Additionally, RT-qPCR assays were also performed for the detection of ruminant pestivirus, in order to detect bovine viral diarrhea cases. Throughout the present methodology, C. fetus was detected in the abomasal fluid samples of 2 bovine fetuses, being both identified as Cfv subspecies by PCR. Histopathological analyses demonstrated that macroscopic and microscopic changes found in the Cfv-positive animals were not either specific or directly related to Campylobacter infections. Moreover, no significant bacterial growth was observed in microbiological culture from the collected tissues, and both fetuses were negative for ruminant pestivirus. Differently, there was no detection of C. fetus in any of the analyzed ovine fetuses.Discussion: Considering that abortion diagnosis rates reported in cattle and sheep industry are highly variable among the published studies, and that abortion diagnoses are commonly inconclusive due to difficulties in sampling methodology and inadequate identification of the pathogen involved, it is important to investigate the etiological causes of abortion the herds for better understanding the causes of pregnancy issues and monitoring their occurrence. In addition, the absence of pathognomonic lesions in the tissues investigated in the histopathological analyses observed in this study strongly suggests that well-known etiological agents commonly associated to abortion, such as Leptospira spp., Toxoplasma spp., Chlamydia spp. and Neospora caninum, are unlikely to be the cause of infection of the analyzed fetuses. Taking this into account, the presence of C. fetus in the abomasal fluid samples from two bovine fetuses demonstrated in the present study suggests the possible association of Cfv not only with infertility, but also with cases of bovine abortion, highlighting the importance of investigating unusual causal agents of abortions in sheep and cattle. Overall, an adequate diagnosis is essential for establishing better prevention strategies to avoid the circulation of abortion-related infectious agents in the herds.Keywords: campylobacteriosis, molecular diagnosis, venereal disease, abortion, reproductive disease.

show abstract

Campylobacter fetus em bovinos no estado do Rio Grande do Sul

Cited by 7 publications

References 11 publications

Prevalence of Campylobacter fetus subsp. venerealis in Dairy Cows from Brejo Paraibano, Brazil

Prevalence of Campylobacter fetus subsp. venerealis in Dairy Cows from Brejo Paraibano, Brazil

Prevalence of Tritrichomonas foetus and Campylobacter fetus subsp. venerealis among bulls slaughtered in the state of Minas Gerais, Brazil

Campylobacter fetus in Abomasal Fluid from Spontaneously Aborted Bovine and Ovine Fetuses

Contact Info

Product

Resources

About