Capillary and microelectrophoretic separations of ligase detection reaction products produced from low‐abundant point mutations in genomic DNA

Abstract

Capillary gel electrophoresis (CGE) and polymer-based microelectrophoretic platforms were investigated to analyze low-abundant point mutations in certain gene fragments with high diagnostic value for colorectal cancers. The electrophoretic separations were carried out on single-stranded DNA (ssDNA) products generated from an allele-specific ligation assay (ligase detection reaction, LDR), which was used to screen for a single base mutation at codon 12 in the K-ras oncogene. The presence of the mutation generated a ssDNA fragment that was >40 base pairs (bp) in length, while the primers used for the ligation assay were <30 bp in length. Various separation matrices were investigated, with the success of the matrix assessed by its ability to resolve the ligation product from the large molar excess of unligated primers when the mutant allele was lower in copy number compared to the wild-type allele. Using CGE, LDR product models (44 and 51 bp) could be analyzed in a cross-linked polyacrylamide gel with a 1000-fold molar excess of LDR primers (25 bp) in approximately 45 min. However, when using linear polyacrylamide gels, these same fragments could not be detected due to significant electrokinetic biasing during injection. A poly(methylmethacrylate) (PMMA) microchip of 3.5 cm effective column length was used with a 4% linear polyacrylamide gel to analyze the products generated from an LDR. When the reaction contained a 100-fold molar excess of wild-type DNA compared to a G12.2D mutant allele, the 44 bp ligation product could be effectively resolved from unligated primers in under 120 s, nearly 17 times faster than the CGE format. In addition, sample cleanup was simplified using the microchip format by not requiring desalting of the LDR prior to loading.

Sensitive Detection of KIT D816V in Patients with Mastocytosis

“…Ligation-based methods also have high detection sensitivities but were not explored in this study because of the relative complexity of the method for the detection of low-abundance point variations (34 ).…”

Functional Connectivity in Healthy Subjects Is Nonlinearly Modulated by the COMT and DRD2 Polymorphisms in a Functional System-Dependent Manner

“…We extracted genomic DNA from 3000 l of whole blood using the EZgeneTM Blood gDNA Miniprep kit (Biomiga). We then determined each subject's genotypes for COMT rs4680 and DRD2 rs1076560 using the PCR and ligation detection reaction (LDR) method (Thomas et al, 2004;Yi et al, 2009) with technical support from the Shanghai Biowing Applied Biotechnology Company. The PCR primer sequences for COMT were as follows: forward, 5Ј GGGCCTACTGTG-GCTACTCA 3Ј; reverse, 5Ј CCCTTTTTCCAGGTCTGACA 3Ј.…”

Prenatal Detection of Beta-Thalassemia CD17 (A→T) Mutation by Polymerase Chain Reaction/Ligase Detection Reaction/Capillary Electrophoresis for Fetal DNA in Maternal Plasma – A Case Report

“…The requirement of base pair complementarity at the nick junction has been explored for the development of ligase-based technologies for low-abundance point mutation detection [13][14][15][16] . PCR/LDR has been successfully applied to the detection of mutations and single nucleotide polymorphisms in cancer genes and pathogens with high specificity and sensitivity [9,[15][16][17][18] . Since only a small percentage of the total circulatory DNA in maternal plasma is of fetal origin, maternal plasma DNA analysis is not widely applied for detecting paternally inherited disorders using common detecting techniques.…”