Carbonic anhydrase IX overexpression regulates the migration and progression in oral squamous cell carcinoma

Abstract

Carbonic anhydrase IX (CAIX) is reportedly overexpressed in several types of carcinomas and is generally considered a marker of malignancy. The current study investigated the association between membrane expression of CAIX and the clinicopathological characteristics in oral squamous cell carcinoma (OSCC) patients. The study used immunohistochemistry to examine CAIX expression in 271 OSCC specimens by tissue microarray (TMA) and assessed the effect of CAIX overexpression and knockdown on migration of oral cancer cells in vitro. We found that CAIX expression was associated with more advanced clinical stages (p = 0.030) and positive lymph node metastasis (p = 0.026). Importantly, CAIX expression was correlated with a poorer patient prognosis in a univariate survival analysis (p = 0.025). Moreover, CAIX suppression by small interfering RNA (siRNA) significantly reduced cellular migration in OECM-1 oral cancer cell. In conclusion, our study showed that the expression of CAIX in OSCC samples can predict the progression of OSCC and survival of OSCC patients in Taiwan.

Antimetastatic effects ofRheum palmatumL. extract on oral cancer cells

“…The total cell lysates were separated through SDS‐PAGE, as described previously . Western blot analysis was performed using specific primary antibodies, such as MMP‐2 (Cell Signaling Technology, Inc. Danvers, MA, USA), β‐actin (BD Biosciences, Bedford, MA, USA), and three MAPKs (ERK 1/2, JNK 1/2, and p38), with the specific antibodies for unphosphorylated or phosphorylated forms (Cell Signaling Technology, Inc. Danvers, MA, USA).…”

“…Total RNA was isolated from SCC‐9 oral cancer cells using the RNeasy Mini Kit (QIAGEN), according to the manufacturer's instructions. The mRNA expression of MMP‐2 was examined through RT‐PCR and quantitative PCR analysis, as previously described . The following primers were used: MMP‐2‐ forward: GGCCCTGTCACTCCTGAGAT, reverse: GGCATCCAGGTTATCGGGGA; GAPDH‐ forward: CGGAGTCAACGGATTTGGTCGTAT, reverse: AGCCTTCTCCATGGTTGGTGAAGAC.…”

“…SCC‐9 cells were seeded at a concentration of 5 × 10 4 cells per well on 6‐well cell culture plates. The pGL3‐basic vector and MMP‐2 promoter plasmid were cotransfected with a β‐galactosidase expression vector into the SCC‐9 cells, according to the methods described by Yang et al…”

Functional genetic variant in the Kozak sequence of WW domain-containing oxidoreductase (WWOX) gene is associated with oral cancer risk

“…OSCC tissue microarray block slides were deparaffinised, as stated in our previous study [51]. The slides were incubated with 1:200 diluted anti-WWOX antibodies (Santa Cruz Biotechnology, Santa Cruz, CA, USA) for 60 min at room temperature.…”

Tumor metabolism, cancer cell transporters, and microenvironmental resistance

“…The CA9 expression is driven by hypoxia 90 , and it is overexpressed preferentially at the edge of the tumor 90 while other did observe it at the core of tumor (necrotic region) 91 . CA9 is correlated with tumor cell invasion/migration 90,92 ; it is associated with poor prognosis of the tumor 93,94 . Also, CA9 is associated with resistance to chemotherapy [95][96][97][98][99] .…”