Caspase-independent death of meiotic and postmeiotic cells overexpressing p53: calpain involvement

Abstract

In a model of male sterility (MTp53) owing to enforced p53 expression in spermatocytes II and spermatids of transgenic mice, we focused on the role of caspases. Most of them are expressed in all differentiation stages, but only the transcriptional levels of caspase-2 and caspase-3 are modified in MTp53 germ cells. In normal testis, cleaved caspase-3 and caspase-9 are detected during the elongation of spermatids. Despite this constitutive presence of caspases during terminal differentiation, calpains are the main effectors of germ cell loss in MTp53 testes: calpain 1 RNA levels are increased, caspase-3-like activity is markedly decreased while calpain activity is higher and the calpain inhibitor E64d ((2S, 3S)-trans-epoxysuccinyl-L-leucylamido-3-methylbutane ethyl ester) reduces TUNEL labeling in MTp53 testis, whereas pancaspase inhibitor zVADfmk (N-benzyloxycarbonyl-ValAla-Asp(OMe)-fluoromethylketone) has no effect. Our work suggests that despite the presence, and potent involvement, of caspases in male haploid cell maturation, calpains are the executioners of the death of terminally differentiating germ cells.

A mitochondrial mechanism is involved in apoptosis of Robertsonian mouse male germ cells

“…It has been reported that Fas/FasL is involved in spermatogenic cell death during development, adulthood and after toxic exposure (Mishra et al 2006). Calpain and the p53 subfamily have also been reported to be involved in male germ cell death (Coureuil et al 2006, Petre-Lazar et al 2007). …”

“…When apoptosis in pachytene spermatocytes occurs as a result of stimuli such as heat or hormone deprivation, it appears that only the intrinsic pathway is stimulated (Sinha Hikim et al 2003). A caspaseindependent mechanism triggered by calpain activation is another mechanism that has been suggested to be involved in germ cell apoptosis (Coureuil et al 2006). Some members of the p53 family and high [Ca 2C ] i also appear to be important regulators of apoptotic death in spermatogenic cells (Mishra et al 2006, Petre-Lazar et al 2007).…”

Caspase‐2L, caspase‐9, and caspase‐3 during in vitro maturation and fragmentation of the mouse oocyte

“…Primers have been previously assayed for the absence of genomic DNA amplification (Coureuil et al, 2006) and all reactions have been performed in parallel with negative controls lacking cell lysates (data not shown).…”

“…Specific primers were used for caspase-2 L (F: ccaggccaaagggggcagtttcag, R: gtgtggttctttccatcttgctgg) (Coureuil et al, 2006), caspase-9 (F: catccttgtgtcctactccacc, R: cagctttttccggaggaagt), caspase-3 (F: gagcactggaatgtcatctcg, R: ttgcgtggaaagtggagtc), and ␤-actin (F: acccacactgtgcccatctac, R: cttcatggtgctaggagccag) as loading control.…”

A g.-1256 A>C in the promoter region of CAPN1 is associated with semen quality traits in Chinese Holstein bulls

“…This complex physiological process includes chromatin reorganization, cytoplasm elimination, acrosome formation, and flagellum development in the seminiferous tubules of the testis and epididymis (O'Donnell et al 2001, Bettegowda et al of laboratory gene chips, as well as their physiological and biochemical functions (Coureuil et al 2006, Macqueen et al 2010, Hering et al 2014. CAPN1 is a calcium-regulated cysteine protease that has been described in a wide range of cellular processes, including apoptosis, migration, and cell-cycle regulation ( Santos et al 2012).…”