Caves Biodiversity in the Marine Area of Riviera d'Ulisse Regional Park, Italy: Grotta del Maresciallo Overview

Abstract

The caves have a significant economic importance in their role as tourist attraction and are of great importance for the presence of some rare species. The fauna identification in the "Grotta del Maresciallo" cave, situated in the Riviera di Ulisse Regional Park, started in march 2013 by a visual census and molecular approach. The studies allowed to detect 12 classes, 46 families, 47 species with their ecological niches, and the percentage contribution of each group to the Mediterranean marine cave diversity. Furthermore, we report the presence of two thermophilic species, as the star coral, Astroides calycularis (Pallas, 1766) and the goldblotch grouper, Epinephelus costae (Steindachner, 1878); the tropical species, the ringneck blenny Parablennius pilicornis (Cuvier, 1829); the endangered species, the dusky grouper Epinephelus marginatus (Lowe, 1834) included in the IUCN Red List; the rare species, the black brotula Grammonus ater (Risso, 1810), and some uncommon species such as the golden coral shrimp, Stenopus spinosus (Risso, 1826) and the spotted bumblebee shrimp, Gnatophillum elegans (Risso, 1816). Species of economic and medical interest were also recorded. In a DNA barcoding approach, Neighbour Joining (NJ) phylogenetic tree of 25 mitochondrial cytochrome oxidase subunit I species sequences, indicates that COI gene is suitable for an unambiguous identification. This first geological and biological attempt at the Marine Area of the "Grotta del Maresciallo" provides useful indications to focus future investigations, and may become a potential management tool for local administrations to protect these habitats.

Fisheries and biodiversity along Mediterranean Sea: Italian and Egyptian coast overview

“…A practical use of barcoding approach updates the database for new species, their discrimination for correct labeling (Di Pinto et al 2015), to avoid substitution of specimens with less economic value, poisoning, and the onset of allergies or just to select properly the species with the highest quantity of antioxidants (Guerriero et al 2008). This species update can contribute to the necessity of periodic checks on the communities' diversity and catalog (Lahaye et al 2008;Crocetta et al 2015) and in particular may become a potential management tool for local administrations to protect Gaeta Gulf and Alexandria Harbor habitats (Scheffers et al 2012;Madonna et al 2015) and the health of ecosystems (Lahaye et al 2008; http://www.rac-spa.org/ sites/default/files/doc_cop/biodiversity.pdf).…”

“…1), the Gaeta Gulf (Italy) and Alexandria Harbor (Egypt). A total of 31 species collected were morphological analyzed, thus a information with regard to intra-Mediterranean biodiversity and population structure at the family level and also our molecular studies in Gaeta Gulf (Guerriero et al 2010;Madonna et al 2015). Our few collections in Alexandria…”

“…The products of nature are the basis for many industrial activities, so it is evident that the importance of biodiversity takes for humans alin the alimentary industry, as a source of food (Hiddink et al 2008;Di Finizio et al 2007). Furthermore, our biodiversity studies help tourism sector too, because a natural environment rich in biodiversity, as well as taking environmental importance, become a real tourist attraction, providing cultural and esthetic benefits (see Madonna et al 2015). A practical use of barcoding approach updates the database for new species, their discrimination for correct labeling (Di Pinto et al 2015), to avoid substitution of specimens with less economic value, poisoning, and the onset of allergies or just to select properly the species with the highest quantity of antioxidants (Guerriero et al 2008).…”

“…DNA barcoding region was amplified, from the 5 0 region of the mitochondrial cytochrome c oxidase subunit I (COI) gene, as previously published (Di Finizio et al 2007) using the following primers: COI_UP (5 0 -ACTTCAGGGTGACC GAAGAATCAGAA-3 0 ) and COI_DW (5 0 -ATCTTTGGT GCATGAGCAGGAATAGT-3 0 ) (Ward et al 2005); 12S, 16S, and cytb, rRNA gene fragments (cytb_UP (5 0 -CCATC CAACATCTCAGCATGATGAAA-3) cytb_DW (5 0 -GCC CCTCAGAATGATATTTGTCCTCA -3 0 ) (Kocher et al 1989;Madonna et al 2015), Finizio et al 2007;Guerriero et al 2010) and PCRs were performed in a Techgene Thermal Cycler (Thecne Ltd., Cambridge, UK). The amplifications were carried out in a reaction buffer containing 50 mM KCl, 10 mM Tris/HCl, pH 9.0; 10 mM NaCl; 0.01 mM EDTA; 2.5 mM of each dNTP; 1 lM of each primer; 10 ng of template DNA; 0.5 unit of Taq DNA polymerase (Invitrogen, Milan, Italy).…”

Comparative Fatty Acid Profiling of Edible Fishes in Kuala Terengganu, Malaysia

“…Fish images were then created using the Inkscape program [40] to show the anatomical characteristics detected for taxonomical identification. Molecular recognition was also conducted for all specimens on 100 mg of fillet using the barcoding method reported in Di Finizio et al [4] using the following primers: COI_UP (5′-ACTTCAGGGTGACCGAAGAATCAGAA-3′) and COI_DW (5′-ATCTTTGGTGCATGAGCAGGAATAGT-3′) [41][42][43]. Using FASTA, the fragments of COI tRNA sequences obtained after amplification, purification, and sequencing were then compared to GenBank similar COI rRNA sequence data [44,45].…”