cDNA-Derived RNA Phage Assembly Reveals Critical Residues in the Maturation Protein of the Pseudomonas aeruginosa Leviphage PP7

Abstract

PP7 is a leviphage with single-stranded RNA genome, which infects Pseudomonas aeruginosa PAO1. A reverse genetic system for PP7 was previously created by using reverse-transcribed cDNA (PP7O) from virion-derived RNA genome. Here, we have found that the PP7O cDNA contained 20 nucleotide differences from the PP7 genome sequence deposited in the database. We created another reverse genetic system exploiting chemically synthesized cDNA (PP7S) based on the database sequence. Unlike PP7O that rendered infectious PP7 virions, PP7S-derived particles were incapable of plaque formation on PAO1 cells, which was restored on the PAO1 cells expressing the maturation protein (MP) from PP7O. Using this reverse genetic system, we revealed two amino acid residues involved in the known roles of MP (i.e. adsorption and genome replication), fortuitously providing a lesson that the viral RNA genome sequencing needs functional verification possibly by a reverse genetic system. IMPORTANCE Biological significance of RNA phages has been largely ignored, ironically because few studies have been focusing on RNA phages. As an initial attempt to properly represent RNA phages in the phageome, we previously created, by using reverse-transcribed cDNA, a reverse genetic system for the small RNA phage, PP7 that infects the opportunistic human pathogen, Pseudomonas aeruginosa. We here report another system by using chemically synthesized cDNA based on the database genome that has 20 nucleotide differences from the previous cDNA. Investigation of those cDNA-derived phage virions unveiled that two amino acids of the maturation protein are crucial for the normal phage lifecycle at different steps. Our study provides an insight into the molecular basis for the RNA phage lifecycle and a lesson that the RNA genome sequencing needs to be carefully validated by cDNA-based phage assembly systems.

Autolysis of Pseudomonas aeruginosa Quorum-Sensing Mutant Is Suppressed by Staphylococcus aureus through Iron-Dependent Metabolism

“…S. aureus cells were grown, and the culture supernatants were precipitated by 10% (v/v) trichloroacetic acid and separated on a 12% (vol/vol) polyacrylamide gel at 100 V for 110 min. The gels were stained with Coomassie Brilliant blue R 250 for 30 min as described elsewhere [ 36 ]. Ammonium sulfate (AS) precipitation was used for partial fractionation of the exoproteins, by altering the AS concentrations.…”

“…Sequencing of arbitrary PCR amplicons CCAATCACTCTCGGACAATAC a Underlining denotes the engineered restriction enzyme sites 110 min. The gels were stained with Coomassie Brilliant blue R 250 for 30 min as described elsewhere [36]. Ammonium sulfate (AS) precipitation was used for partial fractionation of the exoproteins, by altering the AS concentrations.…”

A TetR family regulator of an RND efflux system that directs artemisinin resistance in Vibrio cholerae

“…Transcriptome profiling was carried out by RNA sequencing as described elsewhere ( 23 ), and the RNA levels were determined by RT-qPCR as described previously ( 24 ). Briefly, RNA was extracted from the late-logarithmic growth phase (OD 600 of 0.7) of V. cholerae N16961 and its atrR deletion mutant, using RNeasy Mini Kit (QIAGEN, Germany).…”

“…qPCR was performed on each cDNA sample with a Toyobo Thunderbird SYBR qPCR mix kit and RT-F and RT-R primers (Table S2) on the StepOnePlus real-time PCR system (Applied Biosystems). The relative expression levels were calculated as described elsewhere ( 24 ).…”

An outer membrane determinant for RNA phage genome entry in Pseudomonas aeruginosa

“…PP7 genome synthesis in the infected cells was measured by real-time PCR (qPCR) following reverse transcription (RT) as described elsewhere. 44 Briefly, PAO1 cells were inoculated in LB, grown at 37°C to late-exponential phase (i.e., OD 600 of 1), centrifuged at 10,000 × g for 10 min, and resuspended in 50 μl LB. PP7 phages were added at MOI of 0.1 and allowed to adsorb to the cells at 37°C for 5 min.…”