Cellular localization of orexin receptors in human adrenal gland, adrenocortical adenomas and pheochromocytomas

Blanco, Montserrat; García‐Caballero, Tomás; Fraga, Máximo; Gallego, Rosalı́a; Cuevas, Juan Lagarda; Forteza, Jerónimo; Beiras, A.; Diéguez, Carlos

doi:10.1016/s0167-0115(01)00359-7

Cited by 42 publications

(34 citation statements)

References 32 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…ICC demonstrated that adrenocortical adenomas were provided with OX1-Rs, but not OX2-Rs (Blanco et al, 2002). Using real-time PCR and Western blotting, Spinazzi et al (2005b) not only showed that all cortisol-secreting adenomas examined possessed both OX1-Rs and OX2-Rs but also that their mRNA was significantly up-regulated compared with that in normal adrenal cortex (114% and 63% higher).…”

Section: Orexin and Orexin Receptor Expressionmentioning

confidence: 97%

“…Human adrenal gland. Blanco et al (2002) reported ICC evidence that adrenal cortex and medulla were exclusively provided with OX1-Rs and OX2-Rs, respectively. In contrast, combined RT-PCR, fluorescent in situ hybridization, ICC, and Western blot findings consistently showed that adult and fetal adrenal cortex exclusively expressed the OX2-R Randeva et al, 2001).…”

Section: A Expression Of Orexins and Their Receptorsmentioning

confidence: 99%

“…At variance, the expression of OX2-Rs but not of OX1-Rs, as mRNA and protein, has been demon-OREXINS AND ADRENAL GLAND strated in all benign human pheochromocytomas so far examined (Mazzocchi et al, 2001a;Blanco et al, 2002).…”

Section: Orexin and Orexin Receptor Expressionmentioning

confidence: 99%

See 2 more Smart Citations

Orexins in the Regulation of the Hypothalamic-Pituitary-Adrenal Axis

Spinazzi

Andreis²,

Rossi³

et al. 2006

Pharmacol Rev

162

View full text Add to dashboard Cite

Section: Orexin and Orexin Receptor Expressionmentioning

confidence: 97%

Section: A Expression Of Orexins and Their Receptorsmentioning

confidence: 99%

See 1 more Smart Citation

Orexins in the Regulation of the Hypothalamic-Pituitary-Adrenal Axis

Spinazzi

Andreis²,

Rossi³

et al. 2006

Pharmacol Rev

162

View full text Add to dashboard Cite

“…AACCTACTTACCTCAGTATGAGCTAAACAACGTCTTTACAAGTCTTTTTAAAGAATGGATTGTATCATACTTTGTAAATACTGTAGATAT 1800 TTATTTTTATATATTTTAGATGCTGTGGAATGTTCTAAAATGTACCATATAAAGAACTCTATGTATTTGmammals (Jöhren et al 2001, Blanco et al 2002, Näslund et al 2002, and peripheral actions of orexins are also discussed (Kirchgessner 2002, Smart & Jerman 2002. On the other hand, information on the orexin pathway and its actions are very limited in non-mammalian vertebrates.…”

Section: Atacatcgtcgtgttcatcgtggctctcgtcgggaacgtgctggtttgtattgcagtgtgmentioning

confidence: 99%

cDNA cloning of chicken orexin receptor and tIssue distribution: sexually dimorphic expression in chicken gonads

Ohkubo¹,

Tsukada²,

Shamoto³

2003

Journal of Molecular Endocrinology

View full text Add to dashboard Cite

Orexin-A and -B are known to stimulate food intake in mammals. However, the critical roles of orexins in birds are not fully understood, since orexins have no stimulatory effect on food intake in the chicken. To understand the physiological role(s) of orexins in birds, we have cloned chicken orexin receptor (cOXR) cDNA by RT-PCR, and analysed the tissue distribution of OXR mRNA in the chicken. The cOXR cDNA is 1869 bp long and encodes 501 amino acids. The cloned cDNA for cOXR corresponds to the type 2 OXR in mammals, and shows approximately 80% similarity to those of mammals at the amino acid level. Expression analysis by RNase protection assay revealed OXR mRNA was distributed widely in brain regions, and expression in the cerebrum, hypothalamus and optic tectum were abundant. In peripheral tissues, OXR mRNA was expressed in the pituitary gland, adrenal gland and testis, but no mRNA expression was observed in other tissues examined. Furthermore, we found that the amount of cOXR mRNA was different between testis and ovary, while prepro-orexin mRNA is equally expressed in the gonads of both sexes in the chicken. These data indicate that the orexins have neuroendocrine actions in chickens, which are mediated through hypothalamic receptors as has been observed in mammals. In addition, orexin may have specific role(s) in the regulation of gonadal function in which sex-dependent mechanisms could be involved.

show abstract

“…Several lines of evidence show that orexin-A acts directly on some extrahypothalamic and peripheral tissues. Blanco et al [13] reported expression of OX 2 in the human adrenal medulla. Lopez et al [12] and Malendowiczs et al [14] detected expression of both types of orexin receptors in the adrenal gland with reverse transcriptase polymerase chain reaction (RT-PCR).…”

Section: Introductionmentioning

confidence: 99%

Involvement of the Orexin System in Adrenal Sympathetic Regulation

Nemoto¹,

Toyoshima-Aoyama²,

Ueda³

et al. 2013

Pharmacology

View full text Add to dashboard Cite

Orexin (hypocretin) is a neuropeptide secreted from hypothalamic neurons that is known to be activated during motivated behaviors and active waking. Presently, our knowledge of orexin is mainly limited to the central nervous system, and the involvement of the orexin system in peripheral tissues has received little attention. In the present study, we analyzed the existence of the orexin system in the adrenal medulla, which is part of the sympathetic nervous system. Orexin and its receptors are expressed in the bovine adrenal medulla. Orexins stimulated intracellular calcium changes and epinephrine release from cultured bovine adrenal medullary cells. Applied orexin decreased expression of prepro-orexin, orexin receptor-1 and orexin receptor-2, suggesting negative feedback regulation in the adrenal gland. Our results indicate involvement of the orexin system in the sympathetic regulation of the adrenal medulla.

show abstract

Cellular localization of orexin receptors in human adrenal gland, adrenocortical adenomas and pheochromocytomas

Cited by 42 publications

References 32 publications

Orexins in the Regulation of the Hypothalamic-Pituitary-Adrenal Axis

Orexins in the Regulation of the Hypothalamic-Pituitary-Adrenal Axis

cDNA cloning of chicken orexin receptor and tIssue distribution: sexually dimorphic expression in chicken gonads

Involvement of the Orexin System in Adrenal Sympathetic Regulation

Contact Info

Product

Resources

About