Characterisation of seven polymorphic microsatellites for<i>Nothofagus</i>subgenus<i>Fuscospora</i>from New Zealand

Smissen, Rob D.; Morse, CW; Prada, Diana; Ramón-Laca, Ana; Richardson, SJ

doi:10.1080/0028825x.2012.662903

Cited by 7 publications

(3 citation statements)

References 15 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…We examined 11 simple sequence repeat SSR loci: seven loci described in Smissen et al (2012), three novel loci (not26, not36 and not37) developed using the same library and approach, and ncutas13 from Jones et al (2004). The novel primer sequences (not including the 5′ M13f tail; and where f = forward primer, r = reverse primer) were: not26f CATCCGAATCAAATTCAAGTAA CC, not26r CCTCTTTCGACGTCATTTAGGC; not36f ACTGAGGGACTAACATGGTTTAATTG, not36r GCTGCGTCATCAATACGGG; not37f GC GGTGCTTCGAGCATTAAG, not37r CACTATA CACATTCTGACATTCCTTTC.…”

Section: Simple Sequence Repeat Genotypingmentioning

confidence: 99%

Absence of hybridisation betweenFuscosporaspecies at a site in Arthur's Pass National Park, New Zealand

Smissen

Mitchell

Roth

et al. 2015

New Zealand Journal of Botany

Self Cite

View full text Add to dashboard Cite

We analysed simple sequence repeat markers for a selection of red beech (Fuscospora fusca) and mountain beech (Fuscospora cliffortioides) trees growing together and for seeds collected from them. Our analysis detected neither hybrid trees nor hybrid seeds within our sample. We suggest prezygotic reproductive isolating mechanisms such as differences in flowering time may be important in maintaining boundaries between Fuscospora species despite extensive sympatry.

show abstract

Section: Simple Sequence Repeat Genotypingmentioning

confidence: 99%

Absence of hybridisation betweenFuscosporaspecies at a site in Arthur's Pass National Park, New Zealand

Smissen

Mitchell

Roth

et al. 2015

New Zealand Journal of Botany

Self Cite

View full text Add to dashboard Cite

show abstract

“…) or the genome for Nothofagus solandri (Smissen et al . ). However, both studies rely on one individual, limiting the detection and development of polymorphic markers.…”

Section: Introductionmentioning

confidence: 97%

“…For Fagaceae species, a draft reference genome has been released in 2014 for Castanea mollisima (www.hardwoodgenomics.org/), although gene databases and other genome sequencing projects have been under development in the last few years (Neale & Kremer 2011;Neale et al 2013). For Nothofagaceae species, two NGS projects have been reported using either the transcriptome for N. nervosa (Torales et al 2012) or the genome for Nothofagus solandri (Smissen et al 2012). However, both studies rely on one individual, limiting the detection and development of polymorphic markers.…”

Section: Introductionmentioning

confidence: 99%

Development of genomic resources for Nothofagus species using next‐generation sequencing data

Mujtar

Gallo

Lang

et al. 2014

Molecular Ecology Resources

View full text Add to dashboard Cite

Using next-generation sequencing, we developed the first whole-genome resources for two hybridizing Nothofagus species of the Patagonian forests that crucially lack genomic data, despite their ecological and industrial value. A de novo assembly strategy combining base quality control and optimization of the putative chloroplast gene map yielded ~32,000 contigs from 43% of the reads produced. With 12.5% of assembled reads, we covered ~96% of the chloroplast genome and ~70% of the mitochondrial gene content, providing functional and structural annotations for 112 and 52 genes, respectively. Functional annotation was possible on 15% of the contigs, with ~1750 potentially novel nuclear genes identified for Nothofagus species. We estimated that the new resources (13.41 Mb in total) included ~4000 gene regions representing ~6.5% of the expected genic partition of the genome, the remaining contigs potentially being nongenic DNA. A high-quality single nucleotide polymorphisms resource was developed by comparing various filtering methods, and preliminary results indicate a strong conservation of cpDNA genomes in contrast to numerous exclusive nuclear polymorphisms in both species. Finally, we characterized 2274 potential simple sequence repeat (SSR) loci, designed primers for 769 of them and validated nine of 29 loci in 42 individuals per species. Nothofagus obliqua had more alleles (4.89) on average than N. nervosa (2.89), 8 SSRs were efficient to discriminate species, and three were successfully transferred in three other Nothofagus species. These resources will greatly help for future inferences of demographic, adaptive and hybridizing events in Nothofagus species, and for conserving and managing natural populations.

show abstract

Native New Zealand forget-me-nots (Myosotis, Boraginaceae) comprise a Pleistocene species radiation with very low genetic divergence

2014

View full text Add to dashboard Cite

Characterisation of seven polymorphic microsatellites forNothofagussubgenusFuscosporafrom New Zealand

Cited by 7 publications

References 15 publications

Absence of hybridisation betweenFuscosporaspecies at a site in Arthur's Pass National Park, New Zealand

Absence of hybridisation betweenFuscosporaspecies at a site in Arthur's Pass National Park, New Zealand

Development of genomic resources for Nothofagus species using next‐generation sequencing data

Native New Zealand forget-me-nots (Myosotis, Boraginaceae) comprise a Pleistocene species radiation with very low genetic divergence

Contact Info

Product

Resources

About