Characterisation of the katA gene encoding a catalase and evidence for at least a second catalase activity in Staphylococcus xylosus, bacteria used in food fermentation

Barrière, Charlotte; Brückner, Reinhold; Centeno, Delphine; Talòn, Régine

doi:10.1016/s0378-1097(02)01030-3

Cited by 24 publications

(11 citation statements)

References 29 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Moreover, 23 of the 31 S. xylosus strains analyzed showed restriction profiles similar to that of DSM 20266 T (data not shown). The presence of a second kat gene (katB) in strain S. xylosus DSM 20266 T , similar to the one described by Barrière et al (3), was indicated by TaqI restriction digestion of the KDN-For/KDN-Rev PCR product, and the full nucleotide sequence (accession number AY702101) was determined by inverse PCR experiments, i.e., digesting total DNA with TaqI and using KBSxFI2 (CCTGACGAAGCAGCGAAAAT) and KBSxFI4 (ACGCGTTCACCTTTGTCGTT) as inverse primers in the PCR.…”

Section: Resultssupporting

confidence: 82%

Diversity of Staphylococcus Species Strains Based on Partial kat (Catalase) Gene Sequences and Design of a PCR-Restriction Fragment Length Polymorphism Assay for Identification and Differentiation of Coagulase-Positive Species ( S. aureus , S. delphini , S. hyicus , S. intermedius , S. pseudintermedius

Blaiotta¹,

Fusco

Ercolini

et al. 2010

J Clin Microbiol

View full text Add to dashboard Cite

A set of degenerate PCR primers was designed and used to amplify and sequence about 75% of the catalase (kat) gene from each of 49 staphylococcal strains. In some strains of Staphylococcus xylosus, S. saprophyticus, and S. equorum, two catalase genes, katA and katB, were found. A phylogenetic tree was generated and showed diversities among 66 partial (about 900-bp) staphylococcal kat nucleotide sequences (including 17 sequences found in GenBank) representing 26 different species. The topology of this tree showed a distribution of staphylococcal species similar, but not identical, to those reported previously based on 16S rRNA, hsp60, sodA, rpoB, tuf, and gap genes. The kat gene sequences were less conserved than those of 16S rRNA, rpoB, hsp60, and tuf genes and slightly more conserved than those of the gap gene. Therefore, kat gene sequence analysis may provide an additional marker for inferring phylogenetic relationships of staphylococci. Moreover, the discrete nucleotide polymorphism revealed in this gene could be exploited for rapid, low-cost identification of staphylococcal species through PCR-restriction fragment length polymorphism (RFLP) analysis. In this study, a PCR-RFLP assay performed by using only the TaqI restriction enzyme was successfully developed for rapid unequivocal identification/differentiation, at species and subspecies levels, of coagulase-positive staphylococci (CPS). The assay was validated by testing the DNA from 100 staphylococcal strains, including reference and wild CPS strains isolated from different environments. This reliable, rapid, and low-cost approach (requiring about 6 h from DNA isolation to the achievement of results and <5 Euros for each strain tested) allowed unambiguous identification of all the strains assayed, including the newly described S. delphini and S. pseudintermedius CPS species.

show abstract

Section: Resultssupporting

confidence: 82%

Diversity of Staphylococcus Species Strains Based on Partial kat (Catalase) Gene Sequences and Design of a PCR-Restriction Fragment Length Polymorphism Assay for Identification and Differentiation of Coagulase-Positive Species ( S. aureus , S. delphini , S. hyicus , S. intermedius , S. pseudintermedius

Blaiotta¹,

Fusco

Ercolini

et al. 2010

J Clin Microbiol

View full text Add to dashboard Cite

show abstract

“…The remaining culture was treated with 150 mM hydrogen peroxide (Sigma-Aldrich) and incubated for 1 h at 30°C. 4,000 U/mL of catalase (Sigma–Aldrich) was added to quench residual H 2 O 2 as described (Barrière et al, 2002). Cells were serial-diluted and plated in duplicate on TSA for enumeration of CFU from surviving cells.…”

Section: Methodsmentioning

confidence: 99%

Evidence for Nitric Oxide Synthase Activity in Staphylococcus xylosus Mediating Nitrosoheme Formation

Ras

Zuliani²,

Derkx

et al. 2017

Front. Microbiol.

View full text Add to dashboard Cite

Staphylococcus xylosus is used as a starter culture in fermented meat products and contributes to color formation by the reduction of nitrate to nitrite. Nitrite is a food additive that is chemically turned to nitric oxide (NO) in meat but its safety has been questioned. The objective of this study was to determine the ability of NO synthase (NOS) of S. xylosus C2a to produce NO. For this purpose, a nos deletion mutant (Δnos) in S. xylosus was constructed and NO production was evaluated in a test based on its ability to form nitrosomyoglobin and nitrosoheme. Production of NO was abrogated in the Δnos mutant under aerobic conditions and reduced about 35-40% comparing to the wild type C2a under limited oxygenation. This mutant was sensitive to oxidative stress. The expression of genes encoding catalase was modulated in the mutant with an up-regulation of katA and a down-regulation of katB and katC. The Δnos mutant displayed high colony pigmentation after prolonged growth on agar medium. Finally, the Δnos mutant showed no growth in minimal medium. Growth was not restored in the minimal medium by complementation with nos, but was restored by either addition of phenylalanine or complementation with pdt, a gene that encodes a prephenate dehydratase involved in phenylalanine biosynthesis and co-transcribed with nos. Our findings clearly demonstrate NOS-mediated NO production in S. xylosus, a meat-associated coagulase-negative Staphylococcus.

show abstract

“…The amino acid residues of the active site are very important in preservation of enzyme functions and much research revealed it was rather conserved in catalases [22,23]. According to the amino acid residues of bovine liver catalase site and alignment analysis of amino acid sequence, the active sites of the catalase from Serratia marcescens SYBC08 were consisted of H54, N127, and S93.…”

Section: Gene Cloning and Sequence Analysismentioning

confidence: 99%

Production, characterization, cloning and sequence analysis of a monofunctional catalase from Serratia marcescens SYBC08

Zeng

Cai

Liao

et al. 2010

J. Basic Microbiol.

View full text Add to dashboard Cite

A monofunctional catalase from Serratia marcescens SYBC08 produced by liquid state fermentation in 7 liter fermenter was isolated and purified by ammonium sulfate precipitation (ASP), ion exchange chromatography (IEC), and gel filtration (GF) and characterized. Its sequence was analyzed by LC-MS/MS technique and gene cloning. The highest catalase production (20,289 U · ml(-1)) was achieved after incubation for 40 h. The purified catalase had an estimated molecular mass of 230 kDa, consisting of four identical subunits of 58 kDa. High specific activity of the catalase (199,584 U · mg(-1) protein) was 3.44 times higher than that of Halomonas sp. Sk1 catalase (57,900 U · mg(-1) protein). The enzyme without peroxidase activity was found to be an atypical electronic spectrum of monofunctional catalase. The apparent K(m) and V(max) were 78 mM and 188, 212 per µM H(2) O(2) µM heme(-1) s(-1), respectivly. The enzyme displayed a broad pH activity range (pH 5.0-11.0), with optimal pH range of 7.0-9.0: It was most active at 20 °C and had 78% activity at 0 °C. Its thermo stability was slightly higher compared to that of commercial catalase from bovine liver. LC-MS/MS analysis confirmed that the deduced amino acid sequence of cloning gene was the catalase sequence from Serratia marcescens SYBC08. The sequence was compared with that of 23 related catalases. Although most of active site residues, NADPH-binding residues, proximal residues of the heme, distal residues of the heme and residues interacting with a water molecule in the enzyme were well conserved in 23 related catalases, weakly conserved residues were found. Its sequence was closely related with that of catalases from pathogenic bacterium in the family Enterobacteriaceae. This result imply that the enzyme with high specific activity plays a significant role in preventing those microorganisms of the family Enterobacteriaceae against hydrogen peroxide resulted in cellular damage. Calalase yield by Serratia marcescens SYBC08 has potential industrial application in scavenging hydrogen peroxide.

show abstract

Characterisation of the katA gene encoding a catalase and evidence for at least a second catalase activity in Staphylococcus xylosus, bacteria used in food fermentation

Cited by 24 publications

References 29 publications

Evidence for Nitric Oxide Synthase Activity in Staphylococcus xylosus Mediating Nitrosoheme Formation

Production, characterization, cloning and sequence analysis of a monofunctional catalase from Serratia marcescens SYBC08

Contact Info

Product

Resources

About