Characteristics of Japanase Thalassemia

Hattori, Yukio; Yamashiro, Yasuhiro; Okayama, Naoko; Tanaka, Takahiko; Okano, Kozue; Yamauchi, Hazuki; Ishida, Yoichiro; Kuriya, S

doi:10.1080/09723757.2003.11885861

Cited by 3 publications

(3 citation statements)

References 14 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Our Hb H disease cases were all compound heterozygotes for Àa 3.7 and the Southeast Asian a 0 -thal (--SEA ) type that tends to manifest a milder clinical severity (12,13). The RBCs of b-thal minor and mild Hb H disease are thus not only in a milieu of decreased redox state.…”

Section: Discussionmentioning

confidence: 85%

Oxidation Status of β-Thalassemia Minor and Hb H Disease, and Its Association with Glycerol Lysis Time (GLT₅₀)

et al. 2014

Self Cite

View full text Add to dashboard Cite

β-Thalassemia (β-thal), especially β-thalassemia major (β-TM), is reported to be related to reactive oxygen species (ROS) and enhanced oxidation status. It is reflected by increased malondialdehyde (MDA), by membrane lipid peroxidation and decreased by the newly developed total antioxidant capacity (TAC). However, there is less evidence for β-thal minor and Hb H (β4) disease on its association with oxidation status. On the other hand, hemolysis by glycerol lysis time (GLT50) is invariably prolonged in thalassemia. The reason for the prolongation of GLT50 is not well understood. The aim of this study was to investigate the oxidation state in β-thal minor and Hb H disease and to find out the association of the oxidation with the prolongation of GLT50. Blood samples from 39 subjects (33 with β-thal minor, six with Hb H disease) were collected from individuals living in Japan. The clinical screening tests and molecular identification of the thalassemias were performed. Malondialdehyde and TAC were measured using spectrophotometric analyses. In β-thal minor and Hb H disease, the plasma MDA level was significantly elevated and the TAC reduced. A highly reversed correlation between MDA and TAC was noted. Their GLT50 levels were evidently prolonged, and the GLT50 has significant correlations with MDA and TAC. β-Thalassemia minor and mild Hb H disease are evidently in a milieu of reduced redox state, and GLT50 prolongation in β-thal minor and Hb H disease has a close correlation with the oxidation state, possibly by oxidative impairment of the membrane protein of the red cell.

show abstract

Section: Discussionmentioning

confidence: 85%

Oxidation Status of β-Thalassemia Minor and Hb H Disease, and Its Association with Glycerol Lysis Time (GLT₅₀)

et al. 2014

Self Cite

View full text Add to dashboard Cite

show abstract

“…Since the amount of β T mRNA in our proband was negligible, the possibility of the dominant-type β-thal is very unlikely. Although most Japanese thalassemias are of the minor type (28), their clinical severity sometimes varies depending on the presence of other factors (2,3,29). Our proband revealed moderate anemia with hemolytic involvement, and his blood smear demonstrated moderate aniso-poikilocytosis compatible with severe type of β-thal minor (Figure 2a).…”

Section: Discussionmentioning

confidence: 99%

“…All exons including exon/intron boundaries of the P4.1 gene that is often a cause of Japanese elliptocytosis, were also analyzed (16). Other membrane proteins, ankyrin and Band 3 were also investigated considering their frequency of abnormality in the Japanese population; exons 1,5,6,16,17,22,26,28,31 and 38, and exons 5 and 6 were analyzed for ankyrin and Band 3 genes, respectively ( Table 2). The presence of Southeast Asian type ovalocytosis (SAO) by Band 3 mutation was also analyzed.…”

Section: Dna Analysismentioning

confidence: 99%

A New β⁰-Thalassemia Mutation (codon 102, AAC>ATCAC) in Coexistence with a HeterozygousP4.2 NipponGene

et al. 2013

Self Cite

View full text Add to dashboard Cite

A new β-thalassemia (β-thal) frameshift mutation was found at codon 102 (AAC>ATCAC) in a 17-year-old Japanese male and his 14-year-old sister. Both demonstrated a more severe phenotype than the usual β-thal minor with mild hemolytic involvement. No mRNA derived from the thalassemic allele, or β(T)mRNA, was detected in the sequencing analysis of the whole mRNA (cDNA). However, the β(T)mRNA from the whole βmRNA was specifically amplified by amplification refractory mutation system (ARMS), and was actually found to be present. Furthermore, quantitative polymerase chain reaction (q-PCR) demonstrated a negligible amount of β(T)mRNA. Thus, their more severe phenotype was not caused by the "dominant type" β-thal in which a considerable amount of the β(T)mRNA would be expected. In fact, our proband had a total βmRNA level that was mostly normal. Thus, the cause of a β-thal phenotype by the frameshift mutation was ascribed to the reduced amount of mRNA. We further searched for the cause of their severe phenotype. However, factors that exacerbated the phenotype of β-thal, such as α-globin gene triplication, coexisting iron deficiency and infection were not found. Finally, we noticed that the red cell morphology revealed ovalocytosis and small numbers of stomatocytes that were seen in the hereditary spherocytosis (HS), especially by P4.2 mutations. The sequence of the P4.2 gene disclosed heterozygous P4.2 Nippon, or missense mutation at codon 142 (GCT>ACT) on exon 3, the most common mutation of Japanese HS. Frequent mutations of other membrane proteins, Band 3 and ankyrin that are common cause of HS in the Japanese population, other than P4.2, were not detected. When HS by P4.2 Nippon develops it is homozygous, and no P4.2 protein is observed in sodium dodecilsulphate-polyacrylamide gel electrophoresis (SDS-PAGE), while in our case the amount of the P4.2 was almost normal in the SDS-PAGE. However, there are several reports that revealed more severe phenotypes of β-thal by the coexisting abnormality of membrane protein. It is uncertain, but the presence of heterozygous P4.2 Nippon may be associated with the exacerbation of the phenotype of β-thal minor.

show abstract

Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 ‐20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients

Rizo-de-la-Torre

Ibarra

Sánchez-López

et al. 2017

Int J Lab Hematology

View full text Add to dashboard Cite

show abstract

Characteristics of Japanase Thalassemia

Cited by 3 publications

References 14 publications

Oxidation Status of β-Thalassemia Minor and Hb H Disease, and Its Association with Glycerol Lysis Time (GLT₅₀)

Oxidation Status of β-Thalassemia Minor and Hb H Disease, and Its Association with Glycerol Lysis Time (GLT₅₀)

A New β⁰-Thalassemia Mutation (codon 102, AAC>ATCAC) in Coexistence with a HeterozygousP4.2 NipponGene

Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 ‐20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients

Contact Info

Product

Resources

About

Characteristics of Japanase Thalassemia

Cited by 3 publications

References 14 publications

Oxidation Status of β-Thalassemia Minor and Hb H Disease, and Its Association with Glycerol Lysis Time (GLT50)

Oxidation Status of β-Thalassemia Minor and Hb H Disease, and Its Association with Glycerol Lysis Time (GLT50)

A New β0-Thalassemia Mutation (codon 102, AAC>ATCAC) in Coexistence with a HeterozygousP4.2 NipponGene

Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 ‐20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients

Contact Info

Product

Resources

About

Oxidation Status of β-Thalassemia Minor and Hb H Disease, and Its Association with Glycerol Lysis Time (GLT₅₀)

Oxidation Status of β-Thalassemia Minor and Hb H Disease, and Its Association with Glycerol Lysis Time (GLT₅₀)

A New β⁰-Thalassemia Mutation (codon 102, AAC>ATCAC) in Coexistence with a HeterozygousP4.2 NipponGene