Three novel <i><scp>HBB</scp></i> mutations, c.‐140C&gt;G (‐90 C&gt;G), c.237_256del<scp>GGACAACCTCAAGGGCACCT</scp> (<scp>FS</scp> Cd 78/85 ‐20 bp), and c.315+2T&gt;G (<scp>IVS</scp>2:2 T&gt;G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients

Rizo-de-la-Torre, L. C.; Ibarra, B; Sánchez-López, Josefina Yoaly; Magaña-Torres, María Teresa; Rentería-López, Víctor Manuel; Perea-Díaz, Francisco Javier

doi:10.1111/ijlh.12692

Cited by 2 publications

(1 citation statement)

References 42 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Entre las diferentes variantes de hemoglobina descritas, la hemoglobina S (HbS), C (HbC), E (HbE), beta y alfa talasemia se encuentran entre las variantes de hemoglobina más comunes encontradas en los países de América Latina (Rizo-de-la-Torre et al, 2017).…”

Section: Introductionunclassified

Talasemia: prevalencia, diagnóstico y factores de riesgos

Zambrano-Macías,

Figueroa-Zambrano

2024

MQRInvestigar

View full text Add to dashboard Cite

Las talasemias son enfermedades hereditarias que afectan la síntesis de hemoglobina en los glóbulos rojos, con una alta prevalencia en ciertas regiones como el Mediterráneo, África y el sudeste asiático. El objetivo principal de la presente investigación fue analizar la prevalencia, diagnóstico y factores de riesgo de la talasemia. La metodología tuvo un diseño descriptivo y se utilizó una revisión documental, de los últimos 10 años, de diferentes bases de datos científicos como: Scielo, PubMed, Redalyc, Elservier..., así como datos de páginas web oficiales. Los resultados demostraron que la prevalencia es más alta en países como China y Malasia, Italia y Estados Unidos, así como que, los factores de riesgo para padecer talasemias son la herencia y mutación genética, los efectos migratorios y geográficos, y la consanguinidad de los padres; además que las pruebas de diagnóstico de laboratorio para detectar las talasemias incluyen el hemograma, análisis de ácido desoxirribonucleico y hemoglobina mediante técnicas de electroforesis (capilar o hemoglobina) y cromatografía líquida de alta resolución. En conclusión, las talasemias tuvieron una presencia a nivel mundial, siendo así que los mecanismos para su diagnóstico fueron un análisis de hemograma y ácido desoxirribonucleico, y finalmente conociendo los factores de riesgo más relevantes como la herencia.

show abstract

Section: Introductionunclassified

Talasemia: prevalencia, diagnóstico y factores de riesgos

Zambrano-Macías,

Figueroa-Zambrano

2024

MQRInvestigar

View full text Add to dashboard Cite

show abstract

Three Mexican Families with β thalassemia intermedia with different molecular basis

Ldcr

Fjp

et al. 2019

Genet. Mol. Biol.

View full text Add to dashboard Cite

Beta thalassemia (b-thal) is a frequent monogenic disease, is clinically and molecularly heterogeneous. This study described molecular and laboratory findings for three Mexican patients with b-thal intermedia phenotype and their relatives. Three Mexican families were studied for presenting b-thal intermedia, ARMS-PCR and Gap-PCR were performed to screen for common mutations, Sanger sequencing for rare or new alleles, and MLPA for identifying deletions and or duplications. In all three families we observed, in heterozygote condition, the mutation c.118C > T (p.Gln39*) also known as codon 39(C > T) in the b globin gene (HBB) associated with a novel molecular defect: a new duplication of the alpha globin gene cluster, a new deletion that includes the loss of exon 3 of HBB and finally a novel mutation in the 3'UTR of HBB (HBB: c.*132C > A). We report three Mexican families with beta thalassemia intermedia due to different molecular basis; a new single nucleotide mutation involving the last nucleotide of the b-globin chain transcript; and two possible new DNA rearrangements, an a cluster duplication, and a partial b gene deletion.

show abstract

Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 ‐20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients

Abstract: Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans.

Cited by 2 publications

References 42 publications

Talasemia: prevalencia, diagnóstico y factores de riesgos

Talasemia: prevalencia, diagnóstico y factores de riesgos

Three Mexican Families with β thalassemia intermedia with different molecular basis

Contact Info

Product

Resources

About