Characterization of an extensive rainbow trout miRNA transcriptome by next generation sequencing

Abstract

BackgroundMicroRNAs (miRNAs) have emerged as important post-transcriptional regulators of gene expression in a wide variety of physiological processes. They can control both temporal and spatial gene expression and are believed to regulate 30 to 70 % of the genes. Data are however limited for fish species, with only 9 out of the 30,000 fish species present in miRBase. The aim of the current study was to discover and characterize rainbow trout (Oncorhynchus mykiss) miRNAs in a large number of tissues using next-generation sequencing in order to provide an extensive repertoire of rainbow trout miRNAs.ResultsA total of 38 different samples corresponding to 16 different tissues or organs were individually sequenced and analyzed independently in order to identify a large number of miRNAs with high confidence. This led to the identification of 2946 miRNA loci in the rainbow trout genome, including 445 already known miRNAs. Differential expression analysis was performed in order to identify miRNAs exhibiting specific or preferential expression among the 16 analyzed tissues. In most cases, miRNAs exhibit a specific pattern of expression in only a few tissues. The expression data from sRNA sequencing were confirmed by RT-qPCR. In addition, novel miRNAs are described in rainbow trout that had not been previously reported in other species.ConclusionThis study represents the first characterization of rainbow trout miRNA transcriptome from a wide variety of tissue and sets an extensive repertoire of rainbow trout miRNAs. It provides a starting point for future studies aimed at understanding the roles of miRNAs in major physiological process such as growth, reproduction or adaptation to stress. These rainbow trout miRNAs repertoire provide a novel resource to advance genomic research in salmonid species.Electronic supplementary materialThe online version of this article (doi:10.1186/s12864-016-2505-9) contains supplementary material, which is available to authorized users.

miR-210 expression is associated with methionine-induced differentiation of trout satellite cells

“…miR-133a) and one (miR-210) with unknown function. Based on our previously published miRNA repertoire (Juanchich et al, 2016), we confirmed miR-133a was expressed only in white muscle and showed that miR-210 had strong expression in white muscle. We also showed that miR-210 expression was upregulated during differentiation of satellite cells, suggesting that miR-210 was potentially involved in the differentiation of satellite cells.…”

“…A 1 μg sample of total RNA was used for miRNA cDNA synthesis using a MystiCq MicroRNA cDNA RT kit (MIRRT, Sigma). For miRNA expression assays, forward primer sequences for miRNAs (miR-133a: TTGGTCCCCTTCAACCAGCTG; miR-210: AGCC-ACTGACTAACGTACATTG; miR-375: TTTGTTCGTTCGGC-TCGCGTTA) were taken directly from Juanchich et al (2016), and the universal reverse primer used for all miRNA expression analysis was provided with the MystiCq cDNA reverse transcription kit. For real-time RT-PCR assays of miRNA targets, a Step One Plus thermocycler (Applied Biosystems, Foster City, CA, USA) was used.…”

“…Thus, we compared the expression of miRNAs under the three conditions: presence of methionine (control), absence of methionine for 72 h (Meth−) and absence of methionine for 48 h followed by 24 h of methionine replenishment (Meth−/+). For subsequent analyses, only miRNAs annotated and validated (Juanchich et al, 2016) were conserved. After bioinformatic and statistical analyses, comparison of the three conditions indicated that 53 miRNAs were differentially expressed in at least one condition (Table 1).…”

“…In Paralichthys olivacues, it has been shown that miR-133a targets SRF mRNA (Duran et al, 2015;Su et al, 2015) as in mammals. Recently, we published a miRNA repertoire of a wide variety of tissue that identifies some muscle-specific miRNAs (Juanchich et al, 2016).…”

Genome-wide identification of novel ovarian-predominant miRNAs: new insights from the medaka (Oryzias latipes)

“…Finally, 54 miRNAs (including mmu-miR-6352, hsa-miR-4785, hsa-miR-1305, and hsa-miR-5581) had never been reported as ovarian-predominant miRNAs in any vertebrate species. The expression of some miRNAs observed here in a tissue-dependent manner is consistent with previous results obtained in rainbow trout32. Similarly, it was recently demonstrated in humans that the majority of miRNAs was neither specific to single tissues nor housekeeping miRNAs.…”