Characterization of Five Escherichia coli Isolates Co-expressing ESBL and MCR-1 Resistance Mechanisms From Different Origins in China

Abstract

Present study characterized five Escherichia coli co-expressing ESBL and MCR-1 recovered from food, food-producing animals, and companion animals in China. Antimicrobial susceptibility tests, conjugation experiments, and plasmid typing were performed. Whole genome sequencing (WGS) was undertaken for all five isolates using either PacBio RS II or Illumina HiSeq 2500 platforms. The cefotaxime and colistin resistance encoded by bla CTX–M and mcr-1 genes, respectively, was transferable by conjugation either together or separately for all five strains. Interestingly, the ESBL and mcr-1 genes could be co-selected by cefotaxime, while the colistin only selected the mcr-1 -carrying plasmids during the conjugation experiments. Five E. coli sequence types (ST88, ST93, ST602, ST162, and ST457) were detected. Although diverse plasmid profiles were identified, IncI2, IncFIB, and IncFII plasmid types were predominant. These five clonally unrelated isolates harbored the mcr-1 gene located on similar plasmid backbones, which showed high nucleotide similarity to plasmid pHNSHP45. The mcr-1 gene can be co-transmitted with bla CTX–M genes through IncI2 plasmids with or without IS Apl1 in our study. Characterization of these co-existence ESBL and mcr-1 isolates extends our understanding on the dissemination of these resistance markers among bacteria of diverse origins.

High prevalence of mcr-1-encoded colistin resistance in commensal Escherichia coli from broiler chicken in Bangladesh

“…This association should be cautiously interpreted as the selection and spread of AMR gene is a complex biological process. Although the selection of mcr-1 gene is primarily influenced under the pressure of colistin, other antimicrobials can also co-select mcr-1 gene 32 . Additionally, many factors, such as habitat, co-selection by metals, and biocides, can influence the selection of antimicrobial resistance genes 33 .…”

Prevalence of multidrug resistance genes in Escherichia coli isolates from patients attending four hospitals in Minna, Nigeria

“…The molecular characterization of five E. coli isolates with multidrug resistant index ≥ 0.5 were confirmed using PCR with primers specific for E. coli. DNA was extracted by the protocol described by Zhang et al 3 The integrity of the extracted DNA was checked on a 1% agarose gel to confirm extraction. 3 The ribosomal RNA primer (16SF: GTGCCAGCAGCCGCGCTAA and 16SR: AGACCCGGGAACGTATTCAC) used for the molecular characterisation of the E. coli isolates was obtained from the International Institute of Tropical Agriculture (IITA), Ibadan, Nigeria.…”

“…DNA was extracted by the protocol described by Zhang et al 3 The integrity of the extracted DNA was checked on a 1% agarose gel to confirm extraction. 3 The ribosomal RNA primer (16SF: GTGCCAGCAGCCGCGCTAA and 16SR: AGACCCGGGAACGTATTCAC) used for the molecular characterisation of the E. coli isolates was obtained from the International Institute of Tropical Agriculture (IITA), Ibadan, Nigeria. PCR was carried out on a GeneAmp 9700 PCR System Thermalcycler (Applied Biosystem Inc., USA) following the protocol described by Luo et al 13 The PCR product was loaded on 1.5% agarose gel.…”

“…2 E. coli have been identified as one of the most important multidrug resistant bacteria by the World Health Organization's (WHO) report of priority pathogens, because of their distinct ability to resist antibiotics as well as transfer the mechanism to other bacteria. 3 They are the most common cause of urinary tract infections (UTIs) in humans 4 , as well as a leading cause of food-borne infections primarily due to the Shiga-toxin producing strains. [5][6][7] The problem of antibiotic resistance among bacteria globally and particularly in Nigeria calls for urgent attention.…”

Pan-resistome characterization of uropathogenic Escherichia coli and Klebsiella pneumoniae strains circulating in Uganda and Kenya isolated from 2017-2018

“…UPEC strains from UG are even more alarming as they represent higher number of unusual or novel UTI clones i.e. ST155, ST448 and ST162 with potentially higher virulence levels (Castellanos et al 2017;Choudhury 2018;Zhang et al 2019) compared to those globallyknown STs.…”