Characterization of Fusobacterium nucleatum ATCC 23726 adhesins involved in strain-specific attachment to Porphyromonas gingivalis

Abstract

Bacterial adherence is an essential virulence factor in pathogenesis and infection. Fusobacterium nucleatum has a central role in oral biofilm architecture by acting as a bridge between early Gram-positive and late Gram-negative colonizers that do not otherwise adhere to each other. In this study, we survey a key adherence interaction of F. nucleatum with Porphyromonas gingivalis, and present evidence that multiple fusobacterial adhesins have a role in the attachment of F. nucleatum ATCC 23726 to P. gingivalis in a highly strain-dependent manner. Interaction between these species displayed varying sensitivities to arginine, galactose and lactose. Arginine was found to hamper coaggregation by at least 62% and up to 89% with several P. gingivalis strains and galactose inhibition ranged from no inhibition up to 58% with the same P. gingivalis strains. Lactose consistently inhibited F. nucleatum interaction with these P. gingivalis strains ranging from 40% to 56% decrease in coaggregation. Among the adhesins involved are the previously described Fap2 and surprisingly, RadD, which was described in an earlier study for its function in attachment of F. nucleatum to Gram-positive species. We also provide evidence for the presence of at least one additional adhesin that is sensitive to arginine but unlike Fap2 and RadD, is not a member of the autotransporter family type of fusobacterial large outer membrane proteins. The strain-specific binding profile of multiple fusobacterial adhesins to P. gingivalis highlights the heterogeneity and complexity of interspecies interactions in the oral cavity.

Identification and characterization of a novel Fusobacterium nucleatum adhesin involved in physical interaction and biofilm formation with Streptococcus gordonii

“…Most significantly, these data add an additional layer of complexity to the interaction between F. nucleatum and S. gordonii. Similar complexity seems to be present in the interaction between F. nucleatum and P. gingivalis; while Fap2 appears to be a major adhesin for the interaction of F. nucleatum with P. gingivalis (Coppenhagen-Glazer et al, 2015;Park et al, 2016), RadD plays an additional role in binding to strain 4612 (Park et al, 2016).…”

“…Most significantly, these data add an additional layer of complexity to the interaction between F. nucleatum and S. gordonii . Similar complexity seems to be present in the interaction between F. nucleatum and P. gingivalis ; while Fap2 appears to be a major adhesin for the interaction of F. nucleatum with P. gingivalis (Coppenhagen‐Glazer et al., ; Park et al., ), RadD plays an additional role in binding to strain 4612 (Park et al., ). It is worth mentioning that neither RadD nor Fap2 is involved in the interaction between F. nucleatum and P. gingivalis strain ATCC 33277, implicating the existence of at least one more F. nucleatum adhesin involved in the F. nucleatum – P. gingivalis interaction (Park et al., ).…”

“…To quantify the relative proportions of each species in the respective dual‐species biofilms, previously designed species‐specific primer pairs were used (Park, Shokeen, Haake, & Lux, ). For F. nucleatum ATCC 23726 and its mutant derivatives, a portion of the Fusobacterium ‐specific fomA gene was amplified with Fn‐F (forward) 5′AGAGTTTGATCCTGGCTCAG3′ and Fn‐R (reverse) 5′GTCATCGTGCACACAGAATTGCTG3′ primers.…”

“…To quantify the relative proportions of each species in the respective dual-species biofilms, previously designed species-specific primer pairs were used (Park, Shokeen, Haake, & Lux, 2016). For Scientific, Waltham, MA).…”

Role of FAD-I in Fusobacterial Interspecies Interaction and Biofilm Formation

“…The adhesive nature of Fusobacterium can be attributed to its repertoire of adhesins enabling the binding to various salivary proteins, other microorganisms, and host substrata [14][15][16][17][18]. One fusobacterial adhesin in particular, RadD, was identified as the main adhesin to mediate attachment to a number of gram-positive early colonizers [15] and supports fusobacterial adherence to certain isolates of the periodontal pathogen Porphyromonas gingivalis [19]. The RadD adhesin has also been implicated in the induction of cell death in human lymphocytes [20], indicating that this adhesin may be critical in the establishment of disease.…”