Characterization of Human Astrovirus Cell Entry

Abstract

Human astroviruses (HAstV) are a frequent cause of gastroenteritis in young children and immunocompromised patients. To understand the early steps of HAstV infection in the highly permissive Caco-2 cell line, the binding and entry processes of the virus were characterized. The half-time of virus binding to the cell surface was about 10 min, while virus decapsidation took around 130 min. Drugs affecting clathrin-mediated endocytosis, endosome acidification, and actin filament polymerization, as well as those that reduce the presence of cholesterol in the cell membrane, decreased the infectivity of the virus. The infection was also reduced by silencing the expression of the clathrin heavy chain (CHC) by RNA interference or by overexpression of dominant-negative mutants of dynamin 2 and Eps15. Furthermore, the entry of HAstV apparently depends on the maturation of endosomes, since the infection was reduced by silencing the expression of Rab7, a small GTPase involved in the early-to lateendosome maturation. Altogether, our results suggest that HAstV enters Caco-2 cells using a clathrin-dependent pathway and reaches late endosomes to enter cells. Here, we have characterized the mechanism used by human astroviruses, important agents of gastroenteritis in children, to gain entry into their host cells. Using a combination of biochemical and genetic tools, we found that these viruses enter Caco-2 cells using a clathrin-dependent endocytic pathway, where they most likely need to travel to late endosomes to reach the cytoplasm and begin their replication cycle.

Genome analysis of canine astroviruses reveals genetic heterogeneity and suggests possible inter-species transmission

“…Only in strain HUN/2012/8, this additional in-frame start codon was located 141 nt upstream of the first start codon. During the RNA replication, ORF2 is expressed from a sgRNA (Walter and Mitchell, 2003;Mendez et al, 2014). The sgRNA promoter sequence has a highly conserved nucleotide sequence motif and is present upstream of the ORF2 start codon (Mendez et al, 2014).…”

“…During the RNA replication, ORF2 is expressed from a sgRNA (Walter and Mitchell, 2003;Mendez et al, 2014). The sgRNA promoter sequence has a highly conserved nucleotide sequence motif and is present upstream of the ORF2 start codon (Mendez et al, 2014). The highly conserved nucleotide stretch upstream of ORF2, ATATGGAGGGGAGGACCAAAAAATTGCGATGGC, believed to be part of a promoter region for synthesis of sgRNA, was completely conserved in the sequence of canine AstV strains except for the sequence of strain HUN/2012/8, that was CTTTGGAGGGGAGGACCAAAGCAGCGCTATGGC.…”

Human Astroviruses

“…Drugs that inhibit clathrin-mediated endocytosis and actin filament polymerization, as well as those that reduce the presence of cholesterol in the cell membrane, decrease the infectivity of the virus (69). Furthermore, entry also depends on the acidification and maturation of endosomes where membrane permeabilization and RNA uncoating would occur.…”

“…Furthermore, entry also depends on the acidification and maturation of endosomes where membrane permeabilization and RNA uncoating would occur. Overall, it has been estimated that while the half time of virus binding to the cell surface is about 10 min, virus uncoating takes around 130 min (69).…”

Ecological Drivers of Virus Evolution: Astrovirus as a Case Study

“…Clathrin-dependent pathways appear to be used in Caco-2 cells (18). Crystal structure analysis of the capsid spike domain (the primary binding site) demonstrates drastic differences in the morphology of avastroviruses and mamastroviruses, suggesting a potential host limitation, yet the presence of human seroconversion against turkey astroviruses reveals their immunogenicity when incidental hosts are exposed (15,19).…”