Characterization of human membrane cofactor protein (MCP; CD46) on spermatozoa

Abstract

Membrane cofactor protein (MCP; CD46) is a complement regulator widely expressed as four isoforms that arise via alternative splicing. On human spermatozoa, MCP is expressed on the inner acrosomal membrane and alterations of spermatozoa MCP may be associated with infertility. In rodents, expression of MCP is largely restricted to the testes. MCP on human spermatozoa has a unique M(r) pattern that we have investigated. We also characterized MCP expression in mice transgenic (tg) for human MCP. Human MCP expression in the tg mice mimics the human pattern in that it is located on the inner acrosomal membrane and has a faster M(r) than MCP expressed elsewhere. Sequencing of RT-PCR products from the testis indicates that there is not a unique male reproductive tissue specific cytoplasmic tail. Instead, human spermatozoa express MCP bearing cytoplasmic tail two, which is also utilized in most other tissues and contains several signaling motifs. Further, using N-glycosidases, we demonstrate that the unique lower molecular weight of MCP on spermatozoa is secondary to a modification in the N-linked sugars. Specifically, as the spermatozoa mature, but before they reach the epididymis, the three N-linked sugars of MCP are trimmed to less complex structures. While the purpose of this deglycosylation is unknown, we propose that it is a common feature of proteins expressed on the plasma and inner acrosomal membranes of spermatozoa and hypothesize that it is a spermatozoa specific event critical for facilitating sperm-egg interactions.

Characterization of the Regulation of CD46 RNA Alternative Splicing

“…CD46 exerts such function by acting as a cofactor for Factor I-mediated cleavage of C3b and C4b (1). In addition, CD46 acts as a co-stimulator of T and other immune cells (2)(3)(4)(5)(6) and plays important roles in epithelial and sperm cells (7)(8)(9)(10)(11). Human CD46 deficiency results in a genetic disorder called atypical hemolytic uremic syndrome (12), its overexpression is used by cancer cells to evade the immune system (13,14), and its expression is often altered in autoimmune disorders like multiple sclerosis, rheumatoid arthritis, and asthma (15)(16)(17)(18)(19).…”

Cutting Edge: Inhibiting Measles Virus Infection but Promoting Reproduction: An Explanation for Splicing and Tissue-Specific Expression of CD46

“…Human sperm express MCP on the inner acrosomal membrane (IAM) as a hypoglycosylated form that is not observed in other tissues (3)(4)(5). Sperm-specific abnormalities in MCP have been associated with infertility in humans (6,7).…”

“…RT-PCR was performed as previously described (3). The sequence for the 5Ј primer in the signal peptide was CCTCCCAGCCGCCGCGAGTGT The costs of publication of this article were defrayed in part by the payment of page charges.…”

“…RT-PCR products were cloned and sequenced as reported (3). Sequences were submitted to GenBank under the following accession nos.…”

“…The acrosome reaction was performed as described (3). Freshly washed sperm, either acrosome-reacted (AR) or nonreacted, were stained in the fluid phase.…”