Characterization of the Global Transcriptional Responses to Different Types of DNA Damage and Disruption of Replication in
            <i>Bacillus subtilis</i>

Goranov, Alexi I.; Kuester-Schoeck, Elke; Wang, Jue D.; Grossman, Alan D.

doi:10.1128/jb.00342-06

Cited by 96 publications

(153 citation statements)

References 72 publications

(90 reference statements)

Supporting

Mentioning

146

Contrasting

Order By: Relevance

“…In the strain with oriC at 257°, replication of one arm of the chromosome takes much less time than replication of the other. In addition, head-on transcription and replication appear to cause induction of the SOS response (see Discussion), which can also cause an increase in DnaAdependent replication initiation at oriC (23,28). We postulate that a significant effect of having oriC at 257°is to cause an increase in DnaA-dependent replication initiation.…”

Section: Inhibition Of Replication Elongation In the Head-onmentioning

confidence: 96%

“…This is probably due to DnaAdependent feedback regulation of replication initiation by replication elongation. Initiation at oriC can be stimulated when elongation is inhibited (23,28). In the strain with oriC at 257°, replication of one arm of the chromosome takes much less time than replication of the other.…”

Section: Inhibition Of Replication Elongation In the Head-onmentioning

confidence: 99%

“…Expression of these genes is known to be induced when replication is disrupted (23,28), and we suspect that obstruction of replication elongation within the head-on region may cause some induction of the SOS response. Pile-up of replication forks in the terminus region because of unbalanced replicores might induce replication fork collapse as suggested for E. coli (40) and perhaps contribute to induction of the SOS response.…”

Section: Selective Pressures For Coorientation Of Transcription and Rmentioning

confidence: 99%

“…We monitored DNA content and replication fork progression in synchronously replicating B. subtilis cells by using microarrays to measure the relative amount of DNA for almost all ORFs (22)(23)(24). We synchronized replication in a population of cells by using a mutant (dnaB134) that was temperaturesensitive for the initiation of replication, essentially as described (25,26).…”

Section: Transcription Does Not Detectably Affect Replication Elongatmentioning

confidence: 99%

See 3 more Smart Citations

Genome-wide coorientation of replication and transcription reduces adverse effects on replication in Bacillus subtilis

Wang

Berkmen

Grossman

2007

Proc. Natl. Acad. Sci. U.S.A.

Self Cite

104

119

View full text Add to dashboard Cite

In many bacteria, there is a strong bias for genes to be encoded on the leading strand of DNA, resulting in coorientation of replication and transcription. In Bacillus subtilis, transcription of the majority of genes (75%) is cooriented with replication. By using genomewide profiling of replication with DNA microarrays, we found that this coorientation bias reduces adverse effects of transcription on replication. We found that in wild-type cells, transcription did not appear to affect the rate of replication elongation. However, in mutants with reversed transcription bias for an extended region of the chromosome, replication elongation was slower. This reduced replication rate depended on transcription and was limited to the region in which the directions of replication and transcription are opposed. These results support the hypothesis that the strong bias to coorient transcription and replication is due to selective pressure for processive, efficient, and accurate replication.DNA microarrays ͉ elongation of replication ͉ genomic organization ͉ genomic stability ͉ origin of replication M any aspects of the organization of bacterial genomes are conserved and important for cell survival. DNA rearrangements, including large chromosomal inversions, can lead to inviability, decreased fitness, and impaired development (1-4). It has been proposed that genomic organization affects replication, transcription, and segregation of genomes (5).One benefit of proper genomic organization may be the reduction of potential conflicts between replication and transcription (5-7). The same DNA template is used by RNA polymerase (RNAP) for transcription and by the replisome (DNA polymerase and associated proteins) for replication. Transcription complexes that are stalled, initiating, or terminating can slow or block replication (8, 9). RNAP and the replisome can collide when moving toward each other (head-on), or when the replisome, which moves faster than RNAP, catches up with RNAP moving in the same direction (codirectional). Head-on and codirectional collisions can occur when genes are on the lagging and leading strands, respectively.The consequences of head-on and codirectional collisions are different. In Escherichia coli, high levels of transcription can effectively slow or block progression of replication forks if transcription and replication are head-on, but not if they are codirectional (10). In French's landmark study, an inducible plasmid-derived origin of replication was positioned on either side of an rRNA operon, one of the most highly transcribed operons. Replication fork progression, monitored by EM, was much slower when running against, rather than with, the direction of transcription. Plasmid DNA replication in E. coli can also be hindered by head-on transcription from a strong inducible promoter, probably because of collisions between the replisome and RNAP (ref.

show abstract

Section: Inhibition Of Replication Elongation In the Head-onmentioning

confidence: 96%

Section: Inhibition Of Replication Elongation In the Head-onmentioning

confidence: 99%

Section: Selective Pressures For Coorientation Of Transcription and Rmentioning

confidence: 99%

Section: Transcription Does Not Detectably Affect Replication Elongatmentioning

confidence: 99%

See 2 more Smart Citations

Genome-wide coorientation of replication and transcription reduces adverse effects on replication in Bacillus subtilis

Wang

Berkmen

Grossman

2007

Proc. Natl. Acad. Sci. U.S.A.

Self Cite

104

119

View full text Add to dashboard Cite

show abstract

“…This approach was previously used to identify the SOS regulons of E. coli (Courcelle et al, 2001), B. subtilis (Au et al, 2005;Goranov et al, 2006), Staphylococcus aureus (Cirz et al, 2007) and Pseudomonas aeruginosa (Cirz et al, 2006). The complete SOS regulon has furthermore been determined for Caulobacter crescentus (da Rocha et al, 2008) and Pseudomonas fluorescens (Jin et al, 2007).…”

Section: Discussionmentioning

confidence: 99%

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

et al. 2010

View full text Add to dashboard Cite

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologues, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of a wild-type strain and a DrecA mutant strain after exposure to the DNAdamaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA-regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA-regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DrecA cultures showed considerably lower rifampicin-and streptomycin-resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA-and yneApromoter reporter studies. Stress-survival studies showed DrecA mutant cells to be less resistant to heat, H 2 O 2 and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the host.

show abstract

Visualizing the Replisome, Chromosome Breaks, and Replication Restart in Bacillus subtilis

Gaimster

Winterhalter

Koh

et al. 2022

Methods in Molecular Biology

View full text Add to dashboard Cite

Characterization of the Global Transcriptional Responses to Different Types of DNA Damage and Disruption of Replication in Bacillus subtilis

Cited by 96 publications

References 72 publications

Genome-wide coorientation of replication and transcription reduces adverse effects on replication in Bacillus subtilis

Genome-wide coorientation of replication and transcription reduces adverse effects on replication in Bacillus subtilis

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

Visualizing the Replisome, Chromosome Breaks, and Replication Restart in Bacillus subtilis

Contact Info

Product

Resources

About