The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologues, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of a wild-type strain and a DrecA mutant strain after exposure to the DNAdamaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA-regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA-regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DrecA cultures showed considerably lower rifampicin-and streptomycin-resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA-and yneApromoter reporter studies. Stress-survival studies showed DrecA mutant cells to be less resistant to heat, H 2 O 2 and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the host.

An enzyme that degrades sulfur-containing amino acids was purified from Lactococcus lactis subsp. cremoris B78; this strain was isolated from a mixed-strain, mesophilic starter culture used for the production of Gouda cheese. The enzyme has features of a cystathionine ␤-lyase (EC 4.4.1.8), a pyridoxal-5-phosphate-dependent enzyme involved in the biosynthesis of methionine and catalyzing an ␣,␤-elimination reaction. It is able to catalyze an ␣,␥-elimination reaction as well, which in the case of methionine, results in the production of methanethiol, a putative precursor of important flavor compounds in cheese. The native enzyme has a molecular mass of approximately 130 to 165 kDa and consists of four identical subunits of 35 to 40 kDa. The enzyme is relatively thermostable and has a pH optimum for activity around 8.0; it is still active under cheese-ripening conditions, viz., pH 5.2 to 5.4 and 4% (wt/vol) NaCl. A possible essential role of the enzyme in flavor development in cheese is suggested.

No abstract

A fluorescence method to monitor lysis of cheese starter bacteria using dual staining with the LIVE/DEAD BacLight bacterial viability kit is described. This kit combines membrane-permeant green fluorescent nucleic acid dye SYTO 9 and membrane-impermeant red fluorescent nucleic acid dye propidium iodide (