Characterization of the human granulocyte-macrophage colony-stimulating factor promoter region by genetic analysis: correlation with DNase I footprinting.

Nimer, S.; Morita, E A; Martis, M J; Wachsman, William; Gasson, Judith C.

doi:10.1128/mcb.8.5.1979

Cited by 65 publications

(72 citation statements)

References 42 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…9A). This sequence has been identified in several lymphokinecytokine genes, such as human and mouse granulocytemacrophage colony-stimulating factor (GM-CSF), granulocyte colony-stimulating factor, and IL-3 genes (5,32,40,45) (Fig. 9A).…”

Section: Discussionmentioning

confidence: 99%

Structures of human genes coding for cytokine LD78 and their expression.

Nakao¹,

Nomiyama²,

Shimada³

1990

Mol. Cell. Biol.

113

View full text Add to dashboard Cite

LD78 is a member of a newly identified superfamily of small inducible proteins involved in inflammatory responses, wound healing, and tumorigenesis. Southern blot analysis of the EcoRI-digested human genomic DNAs, using previously isolated LD78 cDNA as a probe, showed that in each individual there are 4.2-and 4.8-kilobase-pair (kb) fragments and that some have an additional 6.5-kb fragment. The 4.2-kb fragment contained genomic DNA sequences corresponding to the LD78 cDNA and was named the LD78a gene. The 4.8-kb fragment contained similar sequences, showing 94% homology to the LD78a gene, and was named the LD78j gene. The LD78a gene was present in a single or a few copies per haploid genome, whereas the copy number of the LD78, gene and of the 6.5-kb fragment hybridizable to LD78 cDNA varied among the samples tested. Treatment of human myeloid cell lines HL-60 and U937 with phorbol 12-myristate 13-acetate (PMA) increased within 2 h cellular levels of the RNA hybridizable to LD78 cDNA. The human glioma cell line U105MG and primary culture of human fibroblasts also expressed the hybridizable RNA in response to PMA. Addition of cycloheximide had no apparent effect on this response in U937 cells and inhibited the response in fibroblasts, whereas it stimulated the response in HL-60 and U1O5MG cells. mRNA phenotyping experiments revealed that the LD78a and LD78I8 genes were both transcribed in PMA-stimulated U937 cells.We formerly isolated a cDNA clone, named pLD78, from a cDNA library constructed on the poly(A)+ RNA of human tonsillar lymphocytes stimulated with phorbol 12-myristate 13-acetate (PMA) and phytohemagglutinin, using a differential screening procedure (33). Sequence analysis of the pLD78 cDNA revealed that it codes for a protein of 92 amino acid residues, including a putative leader sequence. To obtain information on the function of this LD78 protein, we made a computer search of nucleotide and protein sequence data bases and found that it has significant similarity to small inducible mammalian proteins forming a new cytokine superfamily (for reviews, see references 4, 34, and 49). Although the exact functions of the members of this cytokine superfamily are unknown, a monocyte-derived neutrophil chemotactic factor, now called interleukin-8 (IL-8), is one of the best-characterized proteins (21).Among the members of the superfamily, LD78 has 75% sequence similarity with murine macrophage inflammatory protein la (MIP-lot) (10), also called murine L2G25B (20). Accordingly, we presume that LD78 is a human counterpart of murine MIP-la. Murine MIP-la has already been demonstrated to have inflammatory and chemokinetic properties (11,50). Recently, we found that high levels of LD78 gene transcripts are present in acute nonlymphotic as well as lymphotic leukemic cells; hence, LD78 is also probably involved in the neoplastic transformation of hematopoietic cells (51).We have now obtained evidence for at least three different LD78-like genes in the human genome. Among them, we isolated and characterized two highly ho...

show abstract

Section: Discussionmentioning

confidence: 99%

Structures of human genes coding for cytokine LD78 and their expression.

Nakao¹,

Nomiyama²,

Shimada³

1990

Mol. Cell. Biol.

113

View full text Add to dashboard Cite

show abstract

“…The Tax protein has been shown to activate transcription of the genes for IL-2 (52-54), the a chain of IL-2 receptor (IL-2Ra) (55-58), graulocyte-macrophage colony-stimulating factor (59)(60)(61)(62), nerve growth factor (NGF) (63), vimentine (64), and c-fos protooncogene (39). In CD4+ T lymphocytes, it has been postulated that the tax gene plays an important role in leukemogenesis through the IL-2/IL-2Ra autocrine pathway (65,66).…”

Section: Methodsmentioning

confidence: 99%

“…The PCR ( 16) was applied for the detection of proviral DNA. Briefly, we used two primer sets: one is specific for the HTLV-I pX region (SK-43, 5-7335CGGATACCCATGCTAC-GTGT7354-3; SK-44,5-7493GAGCCGATAACGCGTCCATCG7473-3) (17); and the other is specific for human lymphocyte antigen (HLA DQI3) (GH28,5-24CTCGGATTCGCATGTGCTACTTCA CCAAGC45-3; GH29,5-245GAGCTGCAGGTAGTTGTGTCTGCA-CAC227-3) as an internal control (18 60'C, and chain elongation for 3 min at 720C using a DNA thermal cycler (Perkin-Elmer Cetus). One fifth ofthe amplified DNA was then separated by 1.5% agarose gel electrophoresis and visualized by ethidium bromide fluorostaining.…”

Section: Methodsmentioning

confidence: 99%

Overgrowth of human synovial cells driven by the human T cell leukemia virus type I tax gene.

Nakajima¹,

Aono²,

Hasunuma³

et al. 1993

J. Clin. Invest.

View full text Add to dashboard Cite

One of the salient pathological features of rheumatoid arthritis is synovial cell proliferation with bone erosion. Despite extensive investigation, the factors essential for synovial cell proliferation remain to be identified. Recent studies suggest that human T cell leukemia virus type I (HTLV-I) may play an important role in synovial overgrowth observed in patients with one type of chronic inflammatory synovitis. In order to confirm and extend these observations, we have established synovial cell clones (SCCs) from three HTLV-I carriers who demonstrated synovial overgrowth but were otherwise asymptomatic. HTLV-I proviral DNA randomly integrated into the cellular genome was present in 20-30% of SCCs. The SCCs carrying HTLV-I proviral DNA and expressing the tax gene exhibited high levels of proliferative potential. HTLV-I was found to function as a transcriptional trans-activator in these SCCs. Moreover, transfection of the tax expression plasmid into SCCs resulted in the same phenotype of increased proliferation and cytokine expression as exhibited by HTLV-I provirus-carrying and tax-expressing SCCs. These data suggest that tax plays a critical role not only in leukemogenesis but also in synovial overgrowth in humans. (J. Clin. Invest. 1993. 92:186-193.)

show abstract

“…The granulocyte-macrophage colony-stimulating factor (GM-CSF) gene was previously shown to be activated by a TPA-phytohemagglutinin (PHA) or a TPA-calcium ionophore treatment mimicking T-cell activation and upon transient expression of tax1 (7,19,20,23). In a deletion and mutation analysis of the mouse GM-CSF promoter region, two short sequence elements between positions -113 and -73 upstream of the transcriptional start site that were sufficient to confer inducibility to the chloramphenicol transferase (CAT) gene were identified (20).…”

mentioning

confidence: 99%

“…Here, we show that a high-affinity binding site for the NF-KB transcription factor is present in the cis-acting element conferring strong inducibility upon T-cell activation and tax1. The CLE 1 motif which confers only weak inducibility by tax1 is a low-affinity binding site for NF-KB. Combined with the data from the deletion and mutation analysis of the GM-CSF promoter (20,23) purified from the cytosol of human placenta. EMSAs were essentially performed as described previously (25).…”

mentioning

confidence: 99%

NF-kappa B as inducible transcriptional activator of the granulocyte-macrophage colony-stimulating factor gene.

Schreck¹,

Baeuerle²

1990

Mol. Cell. Biol.

199

View full text Add to dashboard Cite

The expression of the gene encoding the granulocyte-macrophage colony-stimulating factor (GM-CSF) is induced upon activation of T cells with phytohemagglutinin and active phorbolester and upon expression of tax,, a transactivating protein of the human T-ceil leukemia virus type I. The same agents induce transcription from the interleukin-2 receptor a-chain and interleukin-2 genes, depending on promoter elements that bind the inducible transcription factor NF-KB (or an NF-KB-like factor). We therefore tested the possibility that the GM-CSF gene is also regulated by a cognate motif for the NF-KB transcription factor. A recent functional analysis by Miyatake et al. (S. Miyatake, M. Seiki, M. Yoshida, and K. Arai, Mol. Cell. Biol. 8:5581-5587, 1988) described a short promoter region in the GM-CSF gene that conferred strong inducibility by T-cell-activating signals and tax1, but no NF-KB-binding motifs were identified. Using electrophoretic mobility shift assays, we showed binding of purified human NF-KB and of the NF-KB activated in Jurkat T cells to an oligonucleotide comprising the GM-CSF promoter element responsible for mediating responsiveness to T-cell-activating signals and tax,. As shown by a methylation interference analysis and oligonucleotide competition experiments, purified NF-KB binds at positions -82 to -91 (GGGAACTACC) of the GM-CSF promoter sequence with an affinity similar to that with which it binds to the biologically functional KB motif in the beta interferon promoter (GGGAAATTCC). Two KB-like motifs at positions -98 to -108 of the GM-CSF promoter were also recognized but with much lower affinities. Our data provide strong evidence that the expression of the GM-CSF gene following T-ceil activation is controlled by binding of the NF-KB transcription factor to a high-affinity binding site in the GM-CSF promoter.

show abstract

Characterization of the human granulocyte-macrophage colony-stimulating factor promoter region by genetic analysis: correlation with DNase I footprinting.

Cited by 65 publications

References 42 publications

Structures of human genes coding for cytokine LD78 and their expression.

Structures of human genes coding for cytokine LD78 and their expression.

Overgrowth of human synovial cells driven by the human T cell leukemia virus type I tax gene.

NF-kappa B as inducible transcriptional activator of the granulocyte-macrophage colony-stimulating factor gene.

Contact Info

Product

Resources

About