Charting DENR-dependent translation reinitiation uncovers predictive uORF features and links to circadian timekeeping via Clock

Abstract

The non-canonical initiation factor DENR promotes translation reinitiation on mRNAs harbouring upstream open reading frames (uORFs). Moreover, DENR depletion shortens circadian period in mouse fibroblasts, suggesting involvement of uORF usage and reinitiation in clock regulation. To identify DENR-regulated translation events transcriptome-wide and, in particular, specific core clock transcripts affected by this mechanism, we have used ribosome profiling in DENR-deficient NIH3T3 cells. We uncovered 240 transcripts with altered translation rate, and used linear regression analysis to extract 5' UTR features predictive of DENR dependence. Among core clock genes, we identified Clock as a DENR target. Using Clock 5' UTR mutants, we mapped the specific uORF through which DENR acts to regulate CLOCK protein biosynthesis. Notably, these experiments revealed an alternative downstream start codon, likely representing the bona fide CLOCK N-terminus. Our findings provide insights into uORF-mediated translational regulation that can regulate the mammalian circadian clock and gene expression at large. regression analysis to characterise 5' UTR features associated with DENR-dependent translational regulation and validate targets identified from our translatome-wide approaches. Finally, we show that DENR regulates efficient CLOCK biosynthesis involving a strong uORF and a so-far unannotated CDS initiation codon. MATERIALS AND METHODSCell culture.NIH3T3 and HEK293FT cells were cultured under standard conditions (DMEM; 10% FCS, 1% penicillin/streptomycin, all from Invitrogen; 37 o C; 5% CO 2 ). Lentiviral particle production in HEK293FT cells using envelope pMD2.G and packaging psPAX2 plasmids, and viral transduction of NIH3T3 cells, were performed following published protocols (10), with puromycin selection at 5 µg/ml for 4 days. Cloning and plasmids.For the generation of lentiviral shRNA expression vectors, two different sequences targeting Denr were cloned into pLKO.1puro backbone vector (Addgene no. 10878 (11)): shRNA1: GTACCACAGAAGGTCACGATA, corresponding to clone TRCN0000308443 of the TRC shRNA Library from the Broad Institute; and shRNA2: GTGCCAAGTTAGATGCGGATT, corresponding to clone TRCN0000098826. pLKO.1puro constructs containing Gfp, and Scramble (Addgene no. 1864) shRNAs served as controls.For the generation of dual luciferase (Firefly/Renilla) reporter plasmids, fragments containing the 5' UTR and first 5-14 codons of the selected DENR targets/controls were amplified by PCR from genomic DNA or cDNA, cloned into the BamHI site of the prLV1 dual luciferase reporter plasmid (12), and validated by sequencing. The following primers were used for PCR: Etaa1, forward (for): aaaggatccGACTTGCAA AGATGGCGCTGCAC, reverse (rev): tttggatccactagtGTCCT TCAGCTGCATTCACATTT; Map2k5, for: aaaggatccGGTT CCGGAGTAACAGCGGTCTAAC, rev: tttggatccactagtGGC CAGCCACAGCATTACAGGTTAA; Lrrc28, for: aaaggatcc GCCGCTGAGTGCCGGTCAGCGGGC, rev: tttggatccactag tGATTTCGGATGCCATGACTGAACA; Klhdc8a, for: aaag gatccGTCTCCGACCCTGTAGACACTGCAG, rev: tttggatc cactagtA...

DAP5 enables translation re-initiation on structured messenger RNAs

“…Consistent with a role in re-initiation, DAP5 function was also sensitive to the inhibition of termination and ribosome recycling. In addition, a subset of the DAP5 targets was less translated in cells deficient for DENR, an initiation/recycling factor previously implicated in the re-initiation of translation in animal cells (Ahmed et al, 2018;Bohlen et al, 2020;Castelo-Szekely et al, 2019;Schleich et al, 2014;Vasudevan et al, 2020).…”

“…eIF2D and the Density-regulated protein (DENR)/Malignant T-cell amplified sequence-1 (MCTS-1) complex recycle 40S ribosomal subunits (Bohlen et al, 2020;Young et al, 2018). In animals, these non-canonical translational factors also promote re-initiation (Ahmed et al, 2018;Bohlen et al, 2020;Castelo-Szekely et al, 2019;Schleich et al, 2017;Schleich et al, 2014;Vasudevan et al, 2020). The underlying mechanism for the function of these proteins in translation re-initiation remains controversial as different functions have been described for these proteins.…”

“…In the absence of DENR, MCTS-1 and eIF2D, R-LUC expression from all reporters was slightly reduced ( Figures S7C, D), suggesting that these factors are not specifically required for re-initiation of translation by DAP5 in the context of WNK1 5′ leader. However, as DENR/MCTS-1 and eIF2D have been shown to selectively support re-initiation after certain uORFs (Ahmed et al, 2018;Bohlen et al, 2020;Castelo-Szekely et al, 2019;Schleich et al, 2017;Schleich et al, 2014), we compared the DAP5 targets with the group of mRNAs showing reduced translation in DENR knockout HeLa cells (Bohlen et al, 2020). Approximately 20% of the DAP5 targets (excluding WNK1) were dependent on DENR for efficient translation ( Figure S7E, Table S3).…”

Integrative analysis allows a global and precise identification of functional miRNA target genes in mESCs

“…The cell pellet was collected by brief centrifugation, snap-frozen in liquid nitrogen and stored at -80°C. From the cell pellets, lysates were prepared and ribosome-protected mRNA fragments were generated by RNase I digestion as previously described using 5 units of RNase I per OD260 (Castelo-Szekely et al, 2019).…”

Synthetic Messenger RNA-Based Vaccines: From Scorn to Hype

“…The sequence of this 5′ UTR can regulate translation. For example, "upstream open reading frames (uORFs)" can control gene expression [26]. Usually, the 5′UTR of very stable mRNAs, such as those utilized by the globin-coding mRNA, are used in ivt mRNA.…”