Chemokine-biased robust self-organizing polarization of migrating cells in vivo

Abstract

The mechanisms facilitating the establishment of front-rear polarity in migrating cells are not fully understood, in particular in the context of bleb-driven directional migration. To gain further insight into this issue we utilized the migration of zebrafish primordial germ cells (PGCs) as an in vivo model. We followed the molecular and morphological cascade that converts apolar cells into polarized bleb-forming motile cells and analyzed the cross dependency among the different cellular functions we identified. Our results underline the critical role of antagonistic interactions between the front and the rear, in particular the role of biophysical processes including formation of barriers and transport of specific proteins to the back of the cell. These interactions direct the formation of blebs to a specific part of the cell that is specified as the cell front. In this way, spontaneous cell polarization facilitates non-directional cell motility and when biased by chemokine signals leads to migration towards specific locations.

Using migrating cells as probes to illuminate features in live embryonic tissues

“…This finding is unexpected considering the differences in gene expression and in certain biophysical properties characteristic of these developing tissues ( 5 ). Following the behavior of the cells within those compartments and determining the localization and dynamics of polarity markers ( 55 ) would shed light on the mechanism responsible for the observed robustness of the amoeboid migration that nPGCs exhibit. Considering the robustness of the migration of nPGCs, it is likely that structures that they cannot cross play key roles in defining developing tissue borders where cell mixing is strongly suppressed.…”

“…One nanoliter of RNAs and/or morpholinos (Gene Tools, OR) were injected into the yolk of one-cellstage embryos unless stated otherwise. In the experiments, the following RNAs were used: egfp-f'-nos3′UTR (30 ng/l) (60), ezrin-ypet-nos3′UTR (30 ng/l) (55), lifeact-mCherry-nos3′UTR (20 ng/l) (55), mCherry-h2b-globin3′UTR (100 ng/l) (33), and h2a-tagBFP-SV40polyA (100 ng/l) (35). Morpholinos used were as follows: 800 M MO-cxcr4a (AGACGATGTGTTCGTAATAAGCCAT, ZFIN-ID ZDB-MRPHLNO-070427-1), 100 M MO-noto (GGGAATCTG-CATGGCGTCTGTTTAG, ZFIN-ID ZDB-MRPHLNO-100514-1), and 350 M MO-tbx16 (CTCTGATAGCCTGCATTATTTAGCC, ZFIN-ID ZDB-MRPHLNO-141217-1) and MO-control (CCTCTTACCT-CAGTTACAATTTATA) at an 800, 100, and 350 M concentration.…”

Gβγ mediates activation of Rho guanine nucleotide exchange factor ARHGEF17 that promotes metastatic lung cancer progression

“…During cell invasion and migration, GPCRs drive actin cytoskeleton reorganization through Rho GTPases, such as RhoA, Rac1, and Cdc42. These GTPases are activated by multidomain signaling proteins called Rho guanine nucleotide exchange factors (RhoGEFs) ( 6 , 7 , 8 ). Specifically, these multidomain effectors are key signaling proteins, and potential therapeutic targets, that set with precision where and which Rho GTPases are loaded with GTP, acquiring an active conformation that control the assembly of different kinds of actin filaments and actomyosin contractile complexes ( 9 , 10 , 11 , 12 ).…”

An AMPK phosphoregulated RhoGEF feedback loop tunes cortical flow–driven amoeboid migration in vivo

“…Hence, they require a flexible migration strategy that enables rapid movement through different cells expressing divergent cell adhesion molecules. One such strategy has been outlined in zebrafish PGCs, where F-actin accumulation templates the site of bleb formation and the subsequent local retrograde cortical actin flow following bleb expansion generates the necessary friction for forward movement ( 12 , 22 , 23 ). Different strategies are likely to exist for other PGCs, including in Drosophila , where, in contrast to zebrafish PGCs, the activity of the small Rho GTPase Rac1 is not polarized ( 24 ) and expression of a dominant-negative Rac1 does not impair trans-epithelial PGC migration ( 25 ).…”