Chemotherapy of dermatophilosis—A preliminary study

Aning, K. G.; Koney, E. B. M.

doi:10.1007/bf02310697

Cited by 5 publications

(3 citation statements)

References 5 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Clinical and bacteriological cures were achieved at the 4th week post treatment representing a 100% cure rate in both groups. Previously, Ilemobade (1984), Aning and Koney (1996), Awad et al (2008), Nath et al (2010 and Gebreyohannes and Gebresselassie (2013) reported the efficacy of long acting oxytetracyclines in the treatment of animal dermatophilosis. Also Gbodi and Ndife (1982), Rosyehuk (1989), Yeruham et al (1995), Reed et al (2004 and Aitken (2007) proved the efficacy of penicillin in the treatment of animal dermatophilosis.…”

Section: Discussionmentioning

confidence: 98%

Clinical and Therapeutic Studies on Dermatophilosis of Sheep and Goats in Quassim, Kingdom of Saudi Arabia

Osman

2015

Assiut Veterinary Medical Journal

View full text Add to dashboard Cite

This study was conducted in Qassim region, central of Saudi Arabia to study the clinical signs associated with dermatophilosis in sheep and goats with therapeutic trials using two treatment regimes. Diagnosis of dermatophilosis was based on the appearance of the characteristic skin lesions on the affected animals and demonstrating the causal organism from the lesions beneath the scabs. Clinically, the examined diseased sheep and goats showed lesions in the form of exudative dermatitis and formation of thick greasy scabs. These lesions were mainly observed on the back of the infected animals. All cases were detected during November, December and January (2013 and 2014). Treatment of the infected animals using long acting oxytetracycline, 3 doses 3 days apart gave the same results as penicillin plus streptomycin administered for five consecutive days. From the technical point of view, it is recommend that long acting oxytetracycline, 3 doses 3 days apart are less demanding than penicillin plus streptomycin for five consecutive days.

show abstract

Section: Discussionmentioning

confidence: 98%

Clinical and Therapeutic Studies on Dermatophilosis of Sheep and Goats in Quassim, Kingdom of Saudi Arabia

Osman

2015

Assiut Veterinary Medical Journal

View full text Add to dashboard Cite

show abstract

“…However, clinical studies have indicated the efficacy of several antimicrobial treatments. Tetracyclines, long acting oxytetracycline in particular, have been shown to be effective in the treatment of dermatophilosis [ 16 , 17 ]. However, using the microbiological criterium, we demonstrated that six isolates had higher susceptibility results for chlortetracycline and tetracycline, strongly indicating that these isolates had an acquired resistance mechanism.…”

Section: Discussionmentioning

confidence: 99%

Identification and Antimicrobial Resistance of Dermatophilus congolensis from Cattle in Saint Kitts and Nevis

Branford

Boyen

Johnson

et al. 2021

Veterinary Sciences

View full text Add to dashboard Cite

Dermatophilosis is a form of dermatitis caused by the bacterium Dermatophilus congolensis. The disease usually presents as localized purulent dermatitis, crusty hair masses or widespread matting of the hair. This condition is most common in domestic ruminants; but it can also affect other wild animals and humans. Antimicrobial therapy is used in many regions to treat clinical dermatophilosis with varying results. In this study, we aimed to assess the antimicrobial susceptibility of D. congolensis isolates. Fifty-two isolates were obtained from animals showing clinical signs of the disease at farms in St. Kitts. The isolates were then confirmed as D. congolensis by phenotypic tests, PCR and MALDI-TOF Mass Spectrometry. Furthermore, minimum inhibitory concentrations (MIC) of 16 antimicrobial agents were determined, using the broth microdilution method. Although most antimicrobials showed MICs in line with published values, the tetracycline results displayed a clear bimodal distribution over the tested range, with most isolates showing low MICs and 6 isolates much higher values (+/− 100-fold increase). These results indicate the presence of acquired tetracycline resistance in D. congolensis on the island of St. Kitts. Whether the current observation has implications for efficacy of treating the disease must be confirmed in further research.

show abstract

“…It presents as a chronic or acute exudative dermatitis with scab formation on the skin. The disease had been reported to be more severe in ruminants and is of particular importance in the tropics and sub‐tropics where it can cause substantial economic losses (Zaria ; Aning & Koney ; Ambrose et al . ; Makinde et al .…”

Section: Introductionmentioning

confidence: 99%

Phylogenetic analysis of Dermatophilus congolensis isolated from naturally infected cattle in Abeokuta and Ilorin, Nigeria

Oladunni

Oyekunle

Talabi

et al. 2016

Veterinary Medicine & Sci

View full text Add to dashboard Cite

Dermatophilus congolensis, the aetiological agent of dermatophilosis, is a pleomorphic, Gram‐positive actinomycete, which infects animals and humans. Often, there is a wrong diagnosis of the infection in animals because of the close resemblance of the organism with other members of the family Actinomycetaceae. In this study, molecular tools were applied to suspected isolates of D. congolensis obtained from naturally infected cattle in Nigeria for confirmation of dermatophilosis. DNA extraction from 54 suspected pure colonies of D. congolensis was carried out using the QIAamp® DNA Mini extraction kit. PCR targeted at the 16S rRNA gene was employed for the confirmation of D. congolensis using 5′‐ACATGCAAGTCGAACGATGA‐3′ and 5′‐ACGCTCGCACCCTACGTATT‐3′ as forward and reverse primers, respectively. Positive amplicons were then sequenced directly using Big Dye Terminator Cycle Sequencing Kit with the forward primers and AmpliTaq‐FS DNA Polymerase. Nucleotide sequences were aligned using bioedit (Ibis Biosciences Carlsbad, CA USA) and the phylogenetic analysis was carried out using mega 5.2 (Center for Evolutionary Medicine and Informatics, The Biodesign Institute, Tempe, Arizona, USA) software programme. The aligned nucleotide sequences of 10 positive D. congolensis isolates had between 94% to 99% homology with the sequences of D. congolensis satellite DNA in GenBank. This result also revealed that the sequenced D. congolensis are of different strains. Phylogenetic analysis revealed that D. congolensis, though closely related to Nocardia brasiliensis (NR 074743.01) and Streptomyces sp. (JN 400114.1), belongs to different genus. In conclusion, molecular tools employed in the study were able to confirm the identity of the test organisms as D. congolensis. It can also be concluded that two strains of D. congolensis obtained from the study can still be accommodated within the previously listed strains available in GenBank while the remaining eight may be different strains of D. congolensis not yet listed in GenBank.

show abstract

Chemotherapy of dermatophilosis—A preliminary study

Cited by 5 publications

References 5 publications

Clinical and Therapeutic Studies on Dermatophilosis of Sheep and Goats in Quassim, Kingdom of Saudi Arabia

Clinical and Therapeutic Studies on Dermatophilosis of Sheep and Goats in Quassim, Kingdom of Saudi Arabia

Identification and Antimicrobial Resistance of Dermatophilus congolensis from Cattle in Saint Kitts and Nevis

Phylogenetic analysis of Dermatophilus congolensis isolated from naturally infected cattle in Abeokuta and Ilorin, Nigeria

Contact Info

Product

Resources

About