Chimeric CYP11B2 / CYP11B1 causing 11β-hydroxylase deficiency in Chinese patients with congenital adrenal hyperplasia

Xu, Lingling; Xia, Weibo; Wu, Xueyan; Wang, Xiaojing; Zhao, Lili; Nie, Min

doi:10.1016/j.steroids.2015.06.002

Cited by 14 publications

(7 citation statements)

References 21 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…As this chimeric CYP11B2/CYP11B1 gene in our study has a similar breakpoint to that of three reported Chinese patients ( 29 , 32 ), we retrieved their detailed genomic sequences around the breakpoints and found that three of these patients (patient 2 and patient 3 in Xu’s study and the patient in Duan’s study) had identical breakpoint as patient 1 in our study (genomic coordinate is chr8:143994517, Figure 3 ). We also analysed the sequence characteristics surrounding the breakpoints and revealed nearby microhomologies (CTCTGGAATCCCTCTTCAAC in patient 1 and GGCCAGGGAC in patient 3) ( Table 3 ).…”

Section: Resultssupporting

confidence: 72%

See 1 more Smart Citation

Detection of Small CYP11B1 Deletions and One Founder Chimeric CYP11B2/CYP11B1 Gene in 11β-Hydroxylase Deficiency

et al. 2022

View full text Add to dashboard Cite

Objective11β-Hydroxylase deficiency (11β-OHD) caused by mutations in the CYP11B1 gene is the second most common form of congenital adrenal hyperplasia. Both point mutations and genomic rearrangements of CYP11B1 are important causes of 11β-OHD. However, the high degree of sequence identity between CYP11B1 and its homologous gene CYP11B2, presents unique challenges for molecular diagnosis of suspected 11β-OHD. The aim of this study was to detect the point mutation, indel, small deletion of CYP11B1 and chimeric CYP11B2/CYP11B1 gene in a one-tube test, improving the genetic diagnosis of 11β-OHD.MethodsOptimized custom-designed target sequencing strategy was performed in three patients with suspected 11β-OHD, in which both the coverage depth of paired-end reads and the breakpoint information of split reads from sequencing data were analysed in order to detect genomic rearrangements covering CYP11B1. Long-range PCR was peformed to validate the speculated CYP11B1 rearrangements with the breakpoint-specifc primers.ResultsUsing the optimized target sequencing approach, we detected two intragenic/intergenic deletions of CYP11B1 and one chimeric CYP11B2/CYP11B1 gene from three suspected patients with 11β-OHD besides three pathogenic heterozygous point mutation/indels. Furthermore, we mapped the precise breakpoint of this chimeric CYP11B2/CYP11B1 gene located on chr8:143994517 (hg19) and confirmed it as a founder rearrangement event in the Chinese population.ConclusionsOur optimized target sequencing approach improved the genetic diagnosis of 11β-OHD.

show abstract

Section: Resultssupporting

confidence: 72%

“…Sanger sequencing (ABI 3700) was performed to decipher the characteristics of the breakpoint. In addition, we attempted CYP11B1- specific long-range PCR to validate the point mutation and indel of CYP11B1 with primers that have been previously reported ( 29 ) ( Supplementary Table 3 ).…”

Section: Methodsmentioning

confidence: 99%

Detection of Small CYP11B1 Deletions and One Founder Chimeric CYP11B2/CYP11B1 Gene in 11β-Hydroxylase Deficiency

et al. 2022

View full text Add to dashboard Cite

show abstract

“…For all of the amplicons, the genomic DNA was denatured at 94 °C for 10 min, followed by 35 cycles of denaturation at 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 1 min 40 s. The final extension was at 72 °C for 10 min. To prevent amplification of highly homologous CYP11B2 sequences, the CYP11B1 gene was amplified in four fragments using four unique primer pairs (Additional file 1 : Table S1: Primers used for PCR assay of CYP11B1 gene) [ 10 , 11 ]. Amplified products were detected by agarose gel electrophoresis and sequenced using an ABI3730 DNA Analyzer (Applied Biosystems).…”

Section: Case Presentationmentioning

confidence: 99%

A Chinese patient with 11β-hydroxylase deficiency due to novel compound heterozygous mutation in CYP11B1 gene: a case report

et al. 2018

View full text Add to dashboard Cite

BackgroundCongenital adrenal hyperplasia (CAH) resulting from steroid 11β-hydroxylase deficiency (11β-OHD) is caused by mutations in the CYP11B1 gene. It is the second major form of CAH associated with hypertension and hypopotassemia. The aim of this study was to provide a genetic analysis of 11β-OHD in a Chinese family.Case presentationA 19-year-old Chinese man was clinically diagnosed with 11β-OHD. His initial clinical manifestations included precocious puberty, hyperpigmentation, hypertension, and hypopotassemia. The patient had taken an overdose of dexamethasone (0.75 mg/d) for more than 10 years before finally developing iatrogenic Cushing’s syndrome. Our aim was to perform a molecular diagnosis of his family. Mutations in the CYP11B1 gene of the patient and his parents were examined using polymerase chain reaction (PCR) resequencing. Additionally, to predict the possible effects of novel mutations on the structure and function of 11β-hydroxylase, these mutations were analyzed by MutationTaster software. Two novel pathogenic mutations were found in the CYP11B1 gene: a heterozygous in-frame insertion deletion mutation c.1440_1447delinsTAAAAG in exon 9 inherited from the father and a heterozygous mutation c.1094_1120delTGCGTGCGGCCCTCAAGGAGACCTTGC (p.364_372del) in exon 6 inherited from the mother.ConclusionsA clear genetic diagnosis can be made by analyzing the functional and structural consequences of CYP11B1 gene mutations that lead to 11β-OHD. Because the dosage of glucocorticoid should be adjusted to minimize the risk of iatrogenic Cushing’s syndrome, clinical follow-up should be conducted with these patients.Electronic supplementary materialThe online version of this article (10.1186/s12902-018-0295-6) contains supplementary material, which is available to authorized users.

show abstract

“…Targeted next-generation sequencing of the patient genome then revealed a large fragment deletion that included exons 1 to 6 of CYP11B1 (Additional file 3 : Figure S1). To validate the deletion, we conducted PCR in proband with mixed oligonucleotide primers that have been previously reported [ 8 ] (a forward primer complementary to the CYP11B2 sequence and a reverse primer complementary to the CYP11B1 sequence) and confirmed a chimeric CYP11B2/CYP11B1 gene. Interestingly, extended familial analysis revealed that the chimera was also present in his mother, uncle and grandfather (Fig.…”

Section: Case Presentationmentioning

confidence: 99%

A novel chimeric CYP11B2/CYP11B1 combined with a new p.L340P CYP11B1 mutation in a patient with 11OHD: case report

et al. 2018

View full text Add to dashboard Cite

Background11β-Hydroxylase deficiency (11OHD) is a common form of congenital adrenal hyperplasia that has been shown to result from inactivating CYP11B1 mutations, and pathogenic CYP11B2/CYP11B1 chimeras contribute to a minority of cases. Heterozygote cases (chimeras combined with missense mutation) are very rare, and genetic analysis of these cases is difficult.Case presentationWe describe an 11OHD patient presenting with precocious pseudopuberty and hypokalemia hypertension who harbored a chimeric CYP11B2/CYP11B1 with a novel breakage point located at g.9559–9742 of CYP11B2. Interestingly, the other allele exhibited a new mutation, p.L340P, in CYP11B1. Bioinformatics and molecular dynamics simulation indicated that p.L340P decreased the stability and changed the surface configuration of 11β-hydroxylase, indicating a disease-causing mutation. Further pedigree study, PCR and next-generation sequencing indicated that the proband carried both the chimera and p.L340P, and coexistence of the two increased the severity of 11OHD in this family. After treatment with combined medications, blood pressure and clinical parameters improved.ConclusionsOur results suggest that chimera screening and CYP11B1 mutation screening should be simultaneously conducted, and pedigree study is necessary.Electronic supplementary materialThe online version of this article (10.1186/s12902-018-0249-z) contains supplementary material, which is available to authorized users.

show abstract

Chimeric CYP11B2 / CYP11B1 causing 11β-hydroxylase deficiency in Chinese patients with congenital adrenal hyperplasia

Cited by 14 publications

References 21 publications

Detection of Small CYP11B1 Deletions and One Founder Chimeric CYP11B2/CYP11B1 Gene in 11β-Hydroxylase Deficiency

Detection of Small CYP11B1 Deletions and One Founder Chimeric CYP11B2/CYP11B1 Gene in 11β-Hydroxylase Deficiency

A Chinese patient with 11β-hydroxylase deficiency due to novel compound heterozygous mutation in CYP11B1 gene: a case report

A novel chimeric CYP11B2/CYP11B1 combined with a new p.L340P CYP11B1 mutation in a patient with 11OHD: case report

Contact Info

Product

Resources

About