Chondromodulin I and pleiotrophin gene expression in bovine cartilage and epiphysis

Azizan, Azliyati; Gaw, Joanne U.; Govindraj, Prasanthi; Tapp, Hazel; Neame, Peter J.

doi:10.1016/s0945-053x(00)00110-4

Cited by 26 publications

(22 citation statements)

References 23 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Differences in pleiotrophin expression exist between fetal cartilage with high levels and mature cartilage with low levels (Neame et al, 1993;Azizan et al, 2000). It would be of interest to assess the level of pleiotrophin expression in the rapidly growing antler to ascertain if there are differences as the antler grows and matures.…”

Section: Discussionmentioning

confidence: 99%

Expression of VEGF and pleiotrophin in deer antler

2006

View full text Add to dashboard Cite

Deer antlers represent a unique model of mammalian regeneration in that they cast and fully regenerate every year. The deer antler thus provides a fascinating model of both rapid angiogenesis and chondrogenesis and the opportunity to investigate unique growth regulatory processes. One such phenomenon is the presence of vascularized cartilage in the growing antler tip-unlike other cartilage, which is typically avascular. The mechanisms by which blood vessels grow in the cartilage as well as the factors that drive antler extension at approximately 1 cm a day have been hitherto largely unknown. The aim of this study was to determine the expression of VEGF and pleiotrophin within the growing antler tip. We isolated cervine VEGF121 and VEGF165 from deer antler and found that mRNA is produced for VEGF in the precartilage and cartilage regions. By in situ hybridization, we examined whether the VEGF receptors Flt-1 and KDR are present in deer antler and found only KDR mRNA within the endothelial cells of the precartilage region. This finding is compatible with VEGF having an angiogenic effect within antler. Pleiotrophin mRNA was found in the vascular smooth muscle cells of the dermis, thus supporting a possible role in vascular growth. High levels of pleiotrophin mRNA were also detected in the precartilage region with possible implications for both angiogenesis and chondrogenesis. This is the first report of cervine angiogenic growth factors within the growing antler tip. Anat Rec Part A, 288A: 1281-1293, 2006. 2006 Key words: angiogenesis; cartilage; chondrogenesis; endothelial Systems where growth occurs at an astonishing rate such as the placenta, embryo, and deer antler can give important insights into the mechanisms involved in angiogenesis. Deer antlers are unique mammalian appendages in that they have an annual cycle of regeneration. During regeneration, the cartilage, skin, nerves, and blood vessels of the antler must grow at a rapid rate. This full regrowth occurs under conditions of low testosterone and high plasma IGF-1 during spring (Li et al., 2003). Antler grows at varying rates in different species, with growth rates reaching 12.5 mm/day in sika deer (Gao and Li, 1988), 27.5 mm/day in moose (Goss, 1970), and approximately 10 mm/day in red deer (Fennessy et al., 1991). Antler growth is driven from the tip, which consists of dermis, mesenchyme, precartilage, and the cartilage that transforms to bone and that then progressively calcifies within the antler (Fig. 1). Antlerogenic stem cells have been found to be concentrated in the reserve mesenchyme underlying the dermis (Li et al., 2002(Li et al., , 2005a. Cells from the reserve mesenchyme divide and differentiate, thus contributing chondroblasts to the precartilage region, where progressive maturation occurs. The cartilage zone contains columns of chondrocytes and large parallel vascular channels, which give a red appearance. In the region shown as the remodeling zone (Fig. 1) THE ANATOMICAL RECORD PART A 288A: 1281-1293 (2006) expand at a rapi...

show abstract

Section: Discussionmentioning

confidence: 99%

Expression of VEGF and pleiotrophin in deer antler

2006

View full text Add to dashboard Cite

show abstract

“…We previously reported that ChM-I mRNA is abundant in the resting and proliferating zones of growth plate chondrocytes (8). ChM-I and remnant ChM-I were immunoprecipitated from monolayer chondrocytes isolated from the proliferating zone of the bovine rib growth plate (Fig.…”

Section: Generation Of Anti-chm-i Antipeptide Antisera-twomentioning

confidence: 97%

“…pChM-I and ChM-I Plasmid Constructs-RNA from bovine epiphyses was isolated as previously described (8) and used as the template for reverse transcription-PCR using primers 6U23 (AAGCCTCCTGGTGT-CCTGCTCCG) and 1111L26 (TCCGTCATGGTCCCTTTAGCTTCAGG). The product was cloned into pCR2.1 (Invitrogen) and then subcloned into pcDNA3.1/Zeo at the BamHI and NotI sites (Invitrogen).…”

Section: Chm-i Plasmid Constructsmentioning

confidence: 99%

“…In the mouse, ChM-I mRNA is found in the thymus and eye but at a lower level than in cartilage (7). The mRNA for ChM-I was shown to be abundant in fetal cartilage and, although present in adult cartilage, was reduced to 5% of the fetal level (8). Immunohistochemistry and in situ hybridization localized ChM-I and its mRNA to the interterritorial matrix of the avascular zones of growth plate cartilage (3).…”

mentioning

confidence: 99%

See 1 more Smart Citation

Post-translational Processing of Bovine Chondromodulin-I

Azizan¹,

Holaday²,

Neame

2001

Journal of Biological Chemistry

Self Cite

View full text Add to dashboard Cite

Chondromodulin-I (ChM-I) is a small glycoprotein that is abundant in fetal cartilage. Mature chondromodulin-I is processed from a larger precursor form, presumably at a proteolytic site RERR-ELVR. The precursor, mature chondromodulin-I and two processed products, the remnant left after removal of mature chondromodulin-I and a smaller, unglycosylated form, were identified using antipeptide antisera. The products of chondromodulin-I precursor processing were seen in cultured chondrocytes, a stable long-term culture chondrosarcoma cell line, as well as Chinese hamster ovary (CHO) cells transfected with an expression plasmid that contained cDNA coding for the chondromodulin-I precursor. Pulse-chase analysis allowed a processing pathway to be analyzed for chondromodulin-I. To further dissect the processing events, three constructs that express recombinant wild-type or mutant chondromodulin-I were transfected into CHO cells. We showed that chondromodulin-I is cleaved intracellularly at the predicted cleavage site, and that the mature glycopeptide is rapidly secreted immediately after processing. The chondromodulin-1 precursor has a short half-life and is not readily apparent in tissue samples, suggesting that chondromodulin is not a member of the juxtacrine family of growth factors, despite some similarities. The smaller unglycosylated form of chondromodulin-I was only observed in cartilage and not in short-term cultures or transfected cells, suggesting an extracellular processing event. No processing occurred when the precursor cleavage site was mutated to RERQ-SLVR or when precursor chondromodulin-I was expressed in the furin-deficient CHO cell line, suggesting the involvement of furin in processing.

show abstract

“…Chondromodulin-I (ChM-I), a 25 kDa glycosylated protein composed of 335 amino acids, was first extracted and cloned from fetal bovine cartilage [3,11]. The major biological functions of ChM-I are to stimulate the proliferation of chondrocytes and inhibit angiogenesis [8][9][10].…”

mentioning

confidence: 99%

Co-localization of Chondromodulin-I (ChM-I) and Bone Morphogenetic Protein-6 (BMP-6) in Myoepithelial Cells of Canine Mammary Tumors

et al. 2005

View full text Add to dashboard Cite

ABSTRACT. To compare the roles of chondromodulin-I (ChM-I) and bone morphogenetic protein-6 (BMP-6) in ectopic mesenchymal tissue formation in canine mammary gland tumors, 33 tumors and 2 normal mammary glands were examined. Immunohistochemical analysis revealed co-expression of ChM-I and BMP-6 in canine mammary tumors. In mixed tumors, newly formed woven bone with ossified cartilage matrix was observed in 4/9 cases. The osteoblasts lining the woven bone showed moderate immunoreactivity to ChM-I and BMP-6. Almost all chondrocytes and proliferative myoepithelial cells within the basement membrane showed intense immunoreactivity to both, and the myoepithelial cells adjacent to the mature cartilage showed the most intense immunoreactivity. The immunoreactivity to ChM-I and BMP-6 of the interstitial myoepithelial cells in the myxomatous stroma varied in each focus of mixed tumors. Similar findings were found in complex adenomas. In simple adenomas, hyperplasic myoepithelial cells within the basement membrane showed moderate immunoreactivity to both markers. Western blot analysis detected a 25 kDa band of ChM-I in fresh tissue samples from three mixed tumors. Our results support the hypothesis that proliferating myoepithelial cells with ChM-I and BMP-6 expression play important roles in mesenchymal metaplasia in canine mammary tumors.

show abstract

Chondromodulin I and pleiotrophin gene expression in bovine cartilage and epiphysis

Cited by 26 publications

References 23 publications

Expression of VEGF and pleiotrophin in deer antler

Expression of VEGF and pleiotrophin in deer antler

Post-translational Processing of Bovine Chondromodulin-I

Co-localization of Chondromodulin-I (ChM-I) and Bone Morphogenetic Protein-6 (BMP-6) in Myoepithelial Cells of Canine Mammary Tumors

Contact Info

Product

Resources

About