Chromosomal ampC genes in Enterobacter species other than Enterobacter cloacae, and ancestral association of the ACT-1 plasmid-encoded cephalosporinase to Enterobacter asburiae

Rottman, Martin

doi:10.1016/s0378-1097(02)00613-4

Cited by 17 publications

(18 citation statements)

References 20 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…ampC, coding for an Ambler class C cephalosporinase, is coded on the chromosome and is universally present in the genus Enterobacter. The clonality of ampC genes on the species level (including E. asburiae and E. hormaechei) has recently been shown (36). Following our PCR-RFLP results, ampC genes seemed to be clonal even on the level of genetic groups.…”

Section: Discussionsupporting

confidence: 77%

Population Genetics of the Nomenspecies Enterobacter cloacae

Hoffmann

Roggenkamp

2003

Appl Environ Microbiol

250

270

View full text Add to dashboard Cite

The genetic heterogeneity of the nomenspecies Enterobacter cloacae is well known. Enterobacter asburiae, Enterobacter cancerogenus, Enterobacter dissolvens, Enterobacter hormaechei, Enterobacter kobei, and Enterobacter nimipressuralis are closely related to it and are subsumed in the so-called E. cloacae complex. DNA-DNA hybridization studies performed previously identified at least five DNA-relatedness groups of this complex. In order to analyze the genetic structure and the phylogenetic relationships between the clusters of the nomenspecies E. cloacae, 206 strains collected from 22 hospitals, a veterinarian, and an agricultural center in 11 countries plus all 13 type strains of the genus and reference strain CDC 1347-71 R were examined with a combination of sequence and PCR-restriction fragment length polymorphism (PCR-RFLP) analyses of the three housekeeping genes hsp60, rpoB, and hemB as well as ampC, the gene of a class C ␤-lactamase. Based on the neighbor-joining tree of the hsp60 sequences, 12 genetic clusters (I to XII) and an unstable sequence crowd (xiii) were identified. The robustness of the genetic clusters was confirmed by analyses of rpoB and hemB sequences and ampC PCR-RFLPs. Sequence crowd xiii split into two groups after rpoB analysis. Only three strains formed a cluster with the type strain of E. cloacae, indicating that the minority of isolates identified as E. cloacae truly belong to the species; 13% of strains grouped with other type strains of the genus, suggesting that the phenotypes of these species seem to be more heterogeneous than so far believed. Three clusters represented 70% of strains, but none of them included a type or reference strain. The genetic clustering presented in this study might serve as a framework for future studies dealing with taxonomic, evolutionary, epidemiological, or pathogenetic characteristics of bacteria belonging to the E. cloacae complex.Enterobacter cloacae has become increasingly important as a nosocomial pathogen, accounting for up to 5% of hospitalacquired septicemias, 5% of nosocomial pneumonias, 4% of nosocomial urinary tract infections, and 10% of postsurgical peritonitis cases (18,35,39). Besides its clinical significance, E. cloacae plays an important role as a pathogen in plants (2, 34) and insects (15) and is ubiquitous in the terrestrial and aquatic environments (22). This diversity of habitats is mirrored by the genetic variety of the nomenspecies E. cloacae, which has been demonstrated in several studies by biotyping and serotyping (16, 47), ribotyping and phage typing (46), pulsed-field gel electrophoresis and enterobacterial repetitive intergenic consensus PCR (ERIC-PCR) (18), and internal transcribed spacer-PCR and random amplification of polymorphic DNA (RAPD)-PCR (6). The 16S ribosomal DNA (rDNA) sequences of E. cloacae did not form a coherent cluster but built a patchy tree, in which the clusters of E. cloacae strains interfused with those of Enterobacter aerogenes, Escherichia coli, Citrobacter species, and Leclercia species. This refl...

show abstract

Section: Discussionsupporting

confidence: 77%

Population Genetics of the Nomenspecies Enterobacter cloacae

Hoffmann

Roggenkamp

2003

Appl Environ Microbiol

250

270

View full text Add to dashboard Cite

show abstract

“…Enterobacter cloacae produces chromosomally encoded ␤-lactamases, also called cephalosporinases (1), and is a serious nosocomial pathogen, the third most prevalent bacterium isolated in intensive care settings (5,8). We report here the study of a new chromosomal AmpC ␤-lactamase produced by E. cloacae FFUL2En isolated from the blood culture of a patient hospitalized in a medicine ward of Hospital de Santa Maria, Lisbon, Portugal.…”

mentioning

confidence: 99%

New Chromosomal AmpC β-Lactamase in Enterobacter cloacae

Conceição

Faria

Pimentel

et al. 2004

Antimicrob Agents Chemother

View full text Add to dashboard Cite

Several members of the Enterobacteriaceae, including Enterobacter spp., are naturally resistant to amoxicillin and cephalosporins. Enterobacter cloacae produces chromosomally encoded ␤-lactamases, also called cephalosporinases (1), and is a serious nosocomial pathogen, the third most prevalent bacterium isolated in intensive care settings (5,8). We report here the study of a new chromosomal AmpC ␤-lactamase produced by E. cloacae FFUL2En isolated from the blood culture of a patient hospitalized in a medicine ward of Hospital de Santa Maria, Lisbon, Portugal. The antibiogram revealed resistance to aminopenicillins, aztreonam, and broad-spectrum cephalosporins, except imipenem, aminoglycosides, and quinolones. By isoelectrofocusing, the sonicate extracts expressed a pI of 8.68, suggesting the presence of a presumed AmpC enzyme.A total DNA preparation from E. cloacae FFUL2En was used in PCR experiments with two sets of primers, TN5 (5Ј-CGTTT GTCAGGCACAGTCAAATCCA) and TN4 (5Ј-TTACTGTAG CGCGTCGAGGATATGG) and the internal primers TN2 (5Ј-TTCCACTGCGGCTGCCAGT) and TN3 (5Ј-CGGATGAGG TCACGGATAACGCC), designed in accordance with consensus sequences from the ampC genes described for E. cloacae and available at GenBank. The amplicon with 1,234 bp was cloned into the SmaI site of the pBK-CMV vector (6) with a TOPO TA cloning kit, resulting in the plasmid p2En1. The ␤-lactam susceptibility pattern of Escherichia coli 2En1, harboring the recombinant plasmid p2En1, displayed cefoxitin, cefuroxime, ceftazidime, and piperacillin plus tazobactam MICs of Ͼ256 g/ml and a cefepime MIC of 0.5 g/ml. The MICs of cefotaxime and aztreonam were lower than those for the parental strain (Table 1). The E. coli 2En1 transformant showed the same pI as the parental strain (pI 8.68), and the substrate profile of the enzyme EcloFFUL2En was determined with the transformant crude enzymatic extract (7). The V max values indicate that cephalothin, with a V max of 3,000.1 M/min, is hydrolyzed more quickly than cefoxitin (V max ϭ 3.7 M/min). Ceftazidime and cefotaxime are not hydrolyzed at detectable levels (V max ϭ Ͻ0.1 M/min).

show abstract

“…E. asburiae has previously been proposed as an ancestor of ACT-1 PABL (Rottman et al, 2002). Strain YMC/KN/03/21 was confirmed as E. hormaechei.…”

Section: Discussionmentioning

confidence: 77%

“…Among these PABLs, ACT-1 was found initially in imipenemresistant Klebsiella pneumoniae with the loss of an outermembrane protein (Bradford et al, 1997). Although an ancestral association of ACT-1 with Enterobacter asburiae was proposed, the nucleotide and amino acid sequence identities were only 96.5 and 98 %, respectively (Rottman et al, 2002).…”

Section: Introductionmentioning

confidence: 99%

Chromosomal cephalosporinase in Enterobacter hormaechei as an ancestor of ACT-1 plasmid-mediated AmpC β-lactamase

Roh

Song

Chung

et al. 2012

Journal of Medical Microbiology

View full text Add to dashboard Cite

In this study of the diversity of AmpC b-lactamase in clinical isolates of Enterobacter spp., a strain was found carrying the plasmid-mediated AmpC b-lactamase ACT-1 gene on its chromosome. The strain was identified as Enterobacter hormaechei using phylogenetic analysis of 16S rRNA and hsp60 genes. In addition, the species was confirmed by DNA-DNA hybridization. The genetic environment of the bla ACT-1 gene was characterized, including the ampR and ampG genes, using a two-step PCR. The amino acid sequences of AmpR at serine 35, arginine 86, glycine 102, aspartic acid 135 and tyrosine 264 were conserved. Measurement of the transcription level of the bla ACT-1 gene using real-time quantitative PCR showed that it increased 1.98-fold following cefoxitin induction. These results suggest that the plasmid-mediated bla ACT-1 gene originated from the chromosome of E. hormaechei.

show abstract

Chromosomal ampC genes in Enterobacter species other than Enterobacter cloacae, and ancestral association of the ACT-1 plasmid-encoded cephalosporinase to Enterobacter asburiae

Cited by 17 publications

References 20 publications

Population Genetics of the Nomenspecies Enterobacter cloacae

Population Genetics of the Nomenspecies Enterobacter cloacae

New Chromosomal AmpC β-Lactamase in Enterobacter cloacae

Chromosomal cephalosporinase in Enterobacter hormaechei as an ancestor of ACT-1 plasmid-mediated AmpC β-lactamase

Contact Info

Product

Resources

About