Circulating mitochondrial DAMPs cause inflammatory responses to injury

Abstract

Injury causes a systemic inflammatory response syndrome (SIRS) clinically much like sepsis 1. Microbial pathogen-associated molecular patterns (PAMPs) activate innate immunocytes through pattern recognition receptors 2. Similarly, cellular injury can release endogenous damage-associated molecular patterns (DAMPs) that activate innate immunity 3. Mitochondria are evolutionary endosymbionts that were derived from bacteria 4 and so might bear bacterial molecular motifs. We show here that injury releases mitochondrial DAMPs (MTD) into the circulation with functionally important immune consequences. MTD include formyl peptides and mitochondrial DNA. These activate human neutrophils (PMN) through formyl peptide receptor-1 and TLR9 respectively. MTD promote PMN Ca2+ flux and phosphorylation of MAP kinases, thus leading to PMN migration and degranulation in vitro and in vivo. Circulating MTD can elicit neutrophil-mediated organ injury. Cellular disruption by trauma releases mitochondrial DAMPs with evolutionarily conserved similarities to bacterial PAMPs into the circulation. These can then signal through identical innate immune pathways to create a sepsis-like state. The release of such mitochondrial ‘enemies within’ by cellular injury is a key link between trauma, inflammation and SIRS.

Circulating cell‐free mitochondrial deoxyribonucleic acid is increased in coronary heart disease patients with diabetes mellitus

“…The mtDNA primer sequences were derived from human nicotinamide adenine dinucleotide dehydrogenase 1 gene on mtDNA, and were 5′‐ATACCCATGGCCAACCTCCT‐3′ (forward) and 5′‐GGGCCTTTGCGTAGTTGTAT‐3′ (reverse)2, 10; The nuclear DNA primers were derived from human β‐globin gene and were 5′‐GTGCACCTGACTCCTGAGGAGA‐3′ (forward) and 5′‐CCTTGATACCAACCTGCCCAG‐3′ (reverse)11. The mitochondrial and β‐globin DNA concentrations in all of the plasma aliquots were determined by quantitative PCR.…”

“…Studies have also shown that ccf‐mtDNA levels are increased in patients or animals with trauma2 and microbial infection3, 4. Furthermore, mtDNA is a damage‐associated molecular pattern5, and can elicit inflammatory response and cause organ injury6, 7.…”

Pathophysiology of heart failure and frailty: a common inflammatory origin?

“…For example, the release of mitochondrial DNA that activates Toll‐like receptor (TLR) 9 induces myocardial inflammation and HF (Oka et al ., 2012). Free mitochondrial DNA in plasma can also activate TLR5 and the NLR‐induced inflammasome (Zhang et al ., 2010; Dall'Olio et al ., 2013). Sterile and microbial inflammation can act simultaneously as exemplified by HF when reduced gut perfusion compromises epithelial surfaces and leads to gut commensal bacteria translocating into the portal circulation.…”

“…Furthermore, defective mitophagy within the myocardium leads to cell death and the release of mitochondrial DNA that activates Toll‐like receptor (TLR) 9 to induce myocardial inflammation, pressure overload, and cardiac hypertrophy leading to HF (Oka et al ., 2012). Defective mitophagy also leads to accumulation of dysfunctional mitochondria which produce more proinflammatory signals, termed mitochondrial damage‐associated molecular patterns (Zhang et al ., 2010; Dall'Olio et al ., 2013). Skeletal muscle from older adults has reduced ATP production, maximal bioenergetic capacity, and mitochondrial content compared to younger counterparts (Short et al ., 2005), and cardiac muscle oxidative phosphorylation capacity is reduced in the earliest stages of heart failure in humans (Diamant et al ., 2003; Hepple, 2016).…”

Mitochondrial DNA Sequence Variants Associated With Blood Pressure Among 2 Cohorts of Older Adults

“…Proximal tubule cells, in particular, are densely packed with mitochondria, given their high energy requirements and limited capacity for anaerobic metabolism,55 and inherited mitochondrial disorders are often characterized by severe proximal tubular dysfunction. Defective mitochondria are deleterious at the intracellular level both because they are unable to produce adequate ATP, and they leak reactive oxygen species, which can trigger inflammation and cell death 56. Although speculative, it is possible that these variants contribute to altered kidney function, which contributes to hypertension development.…”