Clonal Repertoires of Virus-Specific CD8+ T Lymphocytes Are Shared in Mucosal and Systemic Compartments during Chronic Simian Immunodeficiency Virus Infection in Rhesus Monkeys

Abstract

Because it is thought that mucosal tissues play a fundamental role in early HIV/SIV infection, it is crucial to understand the virus-specific responses in mucosal tissues to facilitate devising strategies to prevent and control these infections. We have employed TCR repertoire analyses to define the clonal composition of a dominant SIV epitope-specific CD8(+) T cell population in mucosal and systemic compartments of SIV-infected rhesus monkeys during both acute and chronic infection. We show that the CD8(+) T cell repertoire in mucosal tissues of uninfected rhesus monkeys is oligoclonal, whereas the CD8(+) T cell repertoire in blood is polyclonal. Early postinfection, the SIV-specific CD8(+) T cell clonal repertoire is distinct in mucosal compartments and peripheral blood. However, we observed a narrowing of the virus-specific CD8(+) T cell clonal repertoire in all sampled anatomic compartments as infection progressed from acute to chronic, and there was comparable clonal diversity in all anatomic compartments. We showed during chronic infection that the same clonal populations of virus-specific CD8(+) T cells are present in all compartments. These data indicate that the SIV-specific CD8(+) T cells in systemic and mucosal sites have a shared clonal origin and are, therefore, capable of both responding to infection in the systemic circulation and trafficking to mucosal tissues.

Systemic vaccination induces clonally diverse SIV-specific CD8+ T-cell populations in systemic and mucosal compartments

“…The fourth group consisted of six monkeys infected with SIVmac251 as previously described. 13 We obtained peripheral blood, colon biopsy, duodenal biopsy, and BAL specimens from all the animals.…”

“…Sequence analysis of subcloned TCRB gene products was conducted with Sequencher version 4.9 (Gene Codes, Ann Arbor, MI) as previously described. 13 We have used IMGT nomenclature to assign sequences specific to TCRBV and TCRBJ genes. SUPPLEMENTARY MATERIAL is linked to the online version of the paper at http://www.nature.com/mi…”

“…The cDNA was subjected to template switch-anchored PCR with reverse transcriptase for unbiased amplification of the TCRB chain gene products using a universal primer mix and a C R primer (rhesus monkey TCRBC specific; GATCTCTGCTTCTGATGGCTCAA) as previously described. 13 Purified PCR products were then ligated into the pGEM-T Easy vector (Promega, Madison, WI) and used to transform DH5 Max Efficiency competent E. coli (Invitrogen). A minimum of 100 insert-containing colonies were selected from each sample for sequencing and analysis.…”

“…13 In the present study, we evaluated the clonal repertoire of epitope-specific CD8 + T-cell responses generated by various prime-boost vaccination regimens. Furthermore, we wanted to determine whether systemic prime-boost immunization with recombinant vectors can generate clonally diverse, long-term responses at mucosal sites and whether these mucosal epitope-specific CD8 + T-cell responses are clonally distinct from those seen in peripheral blood.…”

Large granular lymphocytes are universally increased in human, macaque, and feline lentiviral infection

“…We, therefore, believe that the LGL/CD8lo + FAS + phenotype we identified in FIV-infected cats may represent a viral suppressive phenotype. In addition, our finding that CD8 + FAS + cells are polyclonal in FIV-infected cats suggests that these cells are primed to target a diverse MHC repertoire necessary to combat viral infections (Sircar et al, 2010; Zambello et al, 1993). …”