Cloning and functional characterization of the fatty acid elongase 1 (FAE1) gene from high erucic Crambe abyssinica cv. Prophet

Mietkiewska, Elzbieta; Brost, Jennifer M.; Giblin, E. Michael; Barton, Dennis L.; Taylor, David C.

doi:10.1111/j.1467-7652.2007.00268.x

Cited by 47 publications

(38 citation statements)

References 54 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Similarly, the concentration of malonyl-CoA, the 2-C donor, is not limiting under our assay conditions. Similar non-selectivity has been observed when yeast-expressed KCS genes from Tropaeolum (Mietkiewska et al 2004), Teesdalia (Mietkiewska et al 2007a) and Crambe (Mietkiewska et al 2007b) were assayed in vitro. However, in vivo, upon expression of the Lun KCS in Arabidopsis or B. carinata, the proportion of either substrate in the developing seed may limit the degree of very long-chain elongation synthesis.…”

Section: Discussionsupporting

confidence: 65%

“…Our hypothesis was that high erucic acid (HEA) Brassica crops contain only traces of 24:1 in their seed oil, due primarily to the absence of a condensing enzyme (3-ketoacyl-CoA synthase, KCS), also often referred to as a fatty acid elongase or FAE, with a strong capacity to convert 22:1 to 24:1. This suggestion is supported by studies where the KCS genes from Tropaeolum majus (Mietkiewska et al 2004), Crambe abyssinica (Mietkiewska et al 2007b), B. juncea (Kanrar et al 2005) and B. napus (Han et al 2001) have been over-expressed in HEAR Brassicaceae; there is typically a substantial improvement in erucic acid proportions, but no significant 24:1 is produced.…”

Section: Introductionmentioning

confidence: 80%

“…Future work will extend to studying the co-expression of other high erucic KCS genes (e.g. Crambe abyssinica KCS; Mietkiewska et al 2007b), with the Lun KCS, to determine how this may affect the level of nervonic acid in transgenic experiments.…”

Section: Discussionmentioning

confidence: 98%

See 2 more Smart Citations

Increase in nervonic acid content in transformed yeast and transgenic plants by introduction of a Lunaria annua L. 3-ketoacyl-CoA synthase (KCS) gene

et al. 2008

Self Cite

View full text Add to dashboard Cite

Nervonic acid is a Very Long-Chain Monounsaturated Fatty Acid (VLCMFA), 24:1 Delta15 (cis-tetracos-15-enoic acid) found in the seed oils of Lunaria annua, borage, hemp, Acer (Purpleblow maple) and Tropaeolum speciosum (Flame flower). However, of these, only the "money plant" (Lunaria annua L.) has been studied and grown sparingly for future development as a niche crop and the outlook has been disappointing. Therefore, our goal was to isolate and characterize strategic new genes for high nervonic acid production in Brassica oilseed crops. To this end, we have isolated a VLCMFA-utilizing 3-Keto-Acyl-CoA Synthase (KCS; fatty acid elongase; EC 2.3.1.86) gene from Lunaria annua and functionally expressed it in yeast, with the recombinant KCS protein able to catalyze the synthesis of several VLCMFAs, including nervonic acid. Seed-specific expression of the Lunaria KCS in Arabidopsis resulted in a 30-fold increase in nervonic acid proportions in seed oils, compared to the very low quantities found in the wild-type. Similar transgenic experiments using B. carinata as the host resulted in a 7-10 fold increase in seed oil nervonic acid proportions. KCS enzyme activity assays indicated that upon using (14)C-22:1-CoA as substrate, the KCS activity from developing seeds of transgenic B. carinata was 20-30-fold higher than the low erucoyl-elongation activity exhibited by wild type control plants. There was a very good correlation between the Lun KCS transcript intensity and the resultant 22:1-CoA KCS activity in developing seed. The highest nervonic acid level in transgenic B. carinata expressing the Lunaria KCS reached 30%, compared to 2.8% in wild type plant. In addition, the erucic acid proportions in these transgenic lines were considerably lower than that found in native Lunaria oil. These results show the functional utility of the Lunaria KCS in engineering new sources of high nervonate/reduced erucic oils in the Brassicaceae.

show abstract

Section: Discussionsupporting

confidence: 65%

Section: Introductionmentioning

confidence: 80%

See 1 more Smart Citation

Increase in nervonic acid content in transformed yeast and transgenic plants by introduction of a Lunaria annua L. 3-ketoacyl-CoA synthase (KCS) gene

et al. 2008

Self Cite

View full text Add to dashboard Cite

show abstract

“…In total, 62 accessions, representing 14 tribes, 31 genera, 51 species, 4 subspecies and 7 varieties were used in this study. Among these accessions, the entire coding region of FAE1 could be assessed in 26 accessions, whereas only partial fragments could be obtained in the other 36 accessions due to failure of PCR amplification with all four published sets of primers [14,28-30]. All 96 obtained sequences share high homology with the FAE1 gene of Arabidopsis thaliana (GenBank accession: U29142.1), showing an identity higher than 80%.…”

Section: Resultsmentioning

confidence: 99%

“…Four primer sets were selected from the literatures for FAE1 gene amplification: TF, GCAATGACGTCCGTTAACGTTAAG, and TR, GGACCGACCGTTTTGGAC [29]; FAE1F, AGGATCCATACAAATACATCTC, and FAE1R, AGAGAAACATCGTAGCCATCA [28]; F, GCAATGACGTCCATTAACGTAAAG, and R, TTAGGACCGACCGTTTTGGGC [30]; B1F, ATCGGATCCATGACGTCCGTTAACGTAAAGCTCCTT, and B1R, ATCGAATTCTTAGGACCGACCGTTTTGGACA [14]. As to these samples failed to be amplified using the four primer sets, a new primer set (466S, AGATTCAAGAGCGTTCAGG, and 1497AS, TGACATTGCGTAGAGCCAC) was designed based on conserved regions with the aid of OLIGO primer design software (Molecular Biology Insights, Inc., Cascade, Colorado, USA) using the FAE1 sequence of Brassicaceae deposited in the GenBank database.…”

Section: Methodsmentioning

confidence: 99%

Evolutionary Pattern of the FAE1 Gene in Brassicaceae and Its Correlation with the Erucic Acid Trait

Sun

Hui

et al. 2013

PLoS ONE

View full text Add to dashboard Cite

The fatty acid elongase 1 (FAE1) gene catalyzes the initial condensation step in the elongation pathway of VLCFA (very long chain fatty acid) biosynthesis and is thus a key gene in erucic acid biosynthesis. Based on a worldwide collection of 62 accessions representing 14 tribes, 31 genera, 51 species, 4 subspecies and 7 varieties, we conducted a phylogenetic reconstruction and correlation analysis between genetic variations in the FAE1 gene and the erucic acid trait, attempting to gain insight into the evolutionary patterns and the correlations between genetic variations in FAE1 and trait variations. The five clear, deeply diverged clades detected in the phylogenetic reconstruction are largely congruent with a previous multiple gene-derived phylogeny. The Ka/Ks ratio (<1) and overall low level of nucleotide diversity in the FAE1 gene suggest that purifying selection is the major evolutionary force acting on this gene. Sequence variations in FAE1 show a strong correlation with the content of erucic acid in seeds, suggesting a causal link between the two. Furthermore, we detected 16 mutations that were fixed between the low and high phenotypes of the FAE1 gene, which constitute candidate active sites in this gene for altering the content of erucic acid in seeds. Our findings begin to shed light on the evolutionary pattern of this important gene and represent the first step in elucidating how the sequence variations impact the production of erucic acid in plants.

show abstract

Brassica carinata – a new molecular farming platform for delivering bio‐industrial oil feedstocks: case studies of genetic modifications to improve very long‐chain fatty acid and oil content in seeds

Taylor

Falk

Palmer

et al. 2010

Biofuels Bioprod Bioref

Self Cite

113

View full text Add to dashboard Cite

Crop development and species diversity are important aspects of the emerging global bioeconomy, as is maximizing crop value through total crop utilization. We advocate development of Brassica carinata as a biorefinery and bioindustrial oils platform using traditional and molecular breeding techniques and tools. We review genetic studies and breeding efforts to develop elite B. carinata germplasm, work involving development of transformation and regeneration protocols, target gene isolation, and transgene expression. Genetic modification strategies using a B. carinata breeding line as a delivery platform for very long‐chain fatty acid‐enhanced/modified oils are presented as case studies. The target oil products are erucic acid (22:1 Δ13), docosadienoic acid (22:2 Δ5, Δ13) and nervonic acid (24:1 Δ15); in addition transgenic efforts to enhance B. carinata seed oil content are discussed. The overall advantages and current limitations to utilizing this crop are delineated. Other anticipated biobased products from a B. carinata platform may include, but are not limited to, the production of biolubricants, biofuels and biopolymers from the oil, biopesticides, antioxidants, as well as plant gums, and vegetable protein‐based bioplastics and novel food and feed products. In summation, this collaborative B. carinata breeding/germplasm development/value‐added molecular modification effort will not only contribute to the development of renewable feedstocks for the emerging Canadian bioeconomy (biorefinery/bioproducts), but also promises to generate positive economic and environmental benefits. Published in 2010 by John Wiley & Sons, Ltd.

show abstract

Cloning and functional characterization of the fatty acid elongase 1 (FAE1) gene from high erucic Crambe abyssinica cv. Prophet

Cited by 47 publications

References 54 publications

Increase in nervonic acid content in transformed yeast and transgenic plants by introduction of a Lunaria annua L. 3-ketoacyl-CoA synthase (KCS) gene

Increase in nervonic acid content in transformed yeast and transgenic plants by introduction of a Lunaria annua L. 3-ketoacyl-CoA synthase (KCS) gene

Evolutionary Pattern of the FAE1 Gene in Brassicaceae and Its Correlation with the Erucic Acid Trait

Brassica carinata – a new molecular farming platform for delivering bio‐industrial oil feedstocks: case studies of genetic modifications to improve very long‐chain fatty acid and oil content in seeds

Contact Info

Product

Resources

About