Cloning and Structural Characterization of hrp Locus ofPseudomonas syringae pv. pisi.

Abstract

The hrp gene locus of Pseudomonas syringae pv. pisi (P. s. pisi) race 1 was cloned in SuperCosl vector. The nucleotide sequences of hrpA, hrpB and hrpZ were determined, and the deduced amino acid sequences were compared with different races of P. s. pisi and corresponding genes in other bacteria. In particular, over 99% of the similarity in HrpZ (harpin) amino acid sequences was observed among the different races of P. s. pisi. Among P. syringae pathovars, very high similarity was observed, but the level of similarity was considerably lower than that of Erwinia. The HrpZ protein is rich in glycine but lacks cysteine. It is also heat tolerant as has been reported with other bacterial harpins. The carboxyl terminus of harpin also contains two directly repeated sequences of GGGLGTP and QTGT commonly found in P. syringae pv. syringae. It is very interesting to note that a tetrapeptide sequence, GDET, homologous to the hexapeptide Mycosphaerella pinodes-supprescin B (SSGDET) was found in HrpZ of P. s. pisi.

A pea NTPase, PsAPY1, recognizes signal molecules from microorganisms

“…pisi, was prepared as described previously (Nakada et al 1999). Its concentration was determined by the method of Bradford (1976).…”

Flagellin from Pseudomonas syringae pv. tabaci induced hrp-independent HR in tomato

“…We have isolated hrpZ genes that encode the most major harpin proteins in P. syringae pvs. pisi, glycinea, tomato, and tabaci (Nakada et al 1999;Taguchi et al 2001). All hrpZ genes are about 1.1 kb long and potentially encode proteins about 35.3-36.6 kDa, except for hrpZ of P. syringae pv.…”

Degeneration of hrpZ gene in Pseudomonas syringae pv. tabaci to evade tobacco defence: an arms race between tobacco and its bacterial pathogen

“…The hrpZ operon consists of hrpA , hrpZ , hrpB , hrcJ , hrpD and hrpE (He, 1996). To complement the hrpZ gene in the WT strain, a set of primers (pro‐F, 5′‐ cgGAATTC gagctcgatatcccacgtcg‐3′; hrpZ‐R, 5′‐ cgGAATTC tcaggctgcagcctgattgc‐3′; italic letters are noncomplementary nucleotides and capital letters indicate an Eco RI site) was first used to amplify a DNA fragment containing hrpA , hrpZ and the promoter of the hrpZ operon using a cosmid clone that possesses the entire hrpZ operon of Ppi as the template DNA (Nakada et al ., 1999) by polymerase chain reaction (PCR). The PCR product was digested with Eco RI and inserted into an Eco RI‐linearized broad‐host‐range plasmid vector pDSK519 (Keen et al ., 1988) to construct p hrpAZ .…”