Cloning of a gene responsible for the biosynthesis of glutathione in Escherichia coli B

Abstract

A gene (gshI) responsible for-y-glutamylcysteine synthetase (GSH-I) activity was cloned to construct an Escherichia coli B strain having high glutathione synthesizing activity. For this purpose, two E. coli B mutants (strains C912 and RC912) were used. C912 was deficient in GSH-I activity. RC912, a revertant of C912, had a GSH-I activity that was desensitized to feedback inhibition of reduced glutathione. To clone gshI, chromosomal DNAs of RC912 and plasmid vector pBR322 were digested with various restriction endonucleases and then ligated with T4 DNA ligase. The whole ligation mixture was used to transform C912, and the transformants were selected as tetramethylthiuramdisulfide-resistant colonies. Of about 20 resistant colonies, 2 or 3 became red when treated with nitroprusside and showed appreciably high GSH-I activities. The chimeric plasmid DNA, designated pBR322-gshI, was isolated from the strain having the highest GSH-I activity and transformed into RC912. The structure and molecular size of pBR322-gshI in RC912 were determined. The molecular size of this plasmid was 6.2 megadaltons, and the plasmid contained a 3.4-megadalton segment derived from RC912 chromosomal DNA, which included gshI gene. The GSH-I activity of RC912 cells containing pBR322-gshl was fourfold higher than that of RC912 cells without pBR322-gshI.

Metabolic pathway engineering to enhance aerobic degradation of chlorinated ethenes and to reduce their toxicity by cloning a novel glutathione S‐transferase, an evolved toluene o‐monooxygenase, and γ‐glutamylcysteine synthetase

“…The PCR fragment was double digested with Eco RI and Hin dIII and ligated into pMMB277 at the same restriction sites, yielding pMMB277‐isoILR1. The gshI * gene was placed after isoILR1 so both shared the same tac promoter; gshI * from E. coli B was obtained from plasmid pKUGS‐AB (Murata and Kimura, 1982) using PCR amplification with forward primer GF (5′‐ATTTTAAGCTTCGGGAGGTCAATATGATCCCGGACG‐3′) and reverse primer GR (5′‐CTCTCATCCGCCAAAACAG AAGCTTGG CTG‐3′) where the Hin dIII sites are underlined. The PCR product was digested with Hin dIII and ligated into Hin dIII‐digested pMMB277‐isoILR1, resulting in pMMB277‐Ptac‐isoILR1‐gshI* (Fig.…”

“…Synthesis of γ‐glutamylcysteine is rate limiting, and GSHI is feedback inhibited by glutathione (Kelly et al ., 2002). A variant of GSHI, GSHI*, which is desensitized to feedback inhibition of glutathione, has been isolated by Murata and Kimura (1982) and was used here to overexpress GSH.…”

Molecular cloning of the γ‐glutamylcysteine synthetase gene of Saccharomyces cerevisiae

“…GSH-11, the second-step enzyme, catalyzes the formation of GSH from the y-GC and glycine in the presence of ATP. The genes for the GSH-I and GSH-I1 of Escherichia coli were cloned (Murata and Kimura, 1982;Murata et al, 1983) and sequenced (Watanabe et al, 1986;Gushima et al, 1984). In addition, the cDNA for a large subunit of the GSH-I of rat kidney was cloned and sequenced (Yan and Meister, 1990).…”

Phenotype character of the methylglyoxal resistance gene in Saccharomyces cerevisiae: expression in Escherichia coli and application to breeding wild-type yeast strains

“…The whole ligation mixture was used to transform S. cerevisiae DKD-5D-H cells. procedures for plasmids from E. coli cells were the same as those described by Murata and Kimura (22). The purification of plasmids in crude DNA extractg prepared from yeast cells was done by the method of Livingston and Klein (19).…”