Cloning of cDNA Encoding a Novel Mouse DNA Topoisomerase III (Topo IIIβ) Possessing Negatively Supercoiled DNA Relaxing Activity, Whose Message Is Highly Expressed in the Testis

Seki, Takahiko; Seki, Masayuki; Onodera, Ryoko; Katada, Toshiaki; Enomoto, Takemi

doi:10.1074/jbc.273.44.28553

Cited by 46 publications

(37 citation statements)

References 20 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Thus, it seems likely that one of the possible functions of Sgs1 in the meiotic process is to recruit Top3. In this context, it is interesting that mouse Top3␣ and Top3␤ as well as Blm mRNAs were highly expressed in the testis and that the levels of their expression in the testis were increased simultaneously and markedly by 17 days after birth, when numbers of the cells in pachytene phase increase (39,40,41). In addition, it was reported recently that BLM, one of the Sgs1 homologues in higher eukaryotes, was localized on mouse meiotic chromosomes during meiotic DNA recombination (49).…”

Section: Discussionmentioning

confidence: 98%

Sgs1 Helicase Activity Is Required for Mitotic but Apparently Not for Meiotic Functions

Miyajima

Seki

Onoda

et al. 2000

Molecular and Cellular Biology

Self Cite

View full text Add to dashboard Cite

The SGS1 gene of Saccharomyces cerevisiae is a homologue for the Bloom's syndrome and Werner's syndrome genes. The disruption of the SGS1 gene resulted in very poor sporulation, and the majority of the cells were arrested at the mononucleated stage. The recombination frequency measured by a return-to-growth assay was reduced considerably in sgs1 disruptants. However, double-strand break formation, which is a key event in the initiation of meiotic DNA recombination, occurred; crossover and noncrossover products were observed in the disruptants, although the amounts of these products were slightly decreased compared with those in wild-type cells. The spores produced by sgs1 disruptants showed relatively high viability. The sgs1 spo13 double disruptants sporulated poorly, like the sgs1 disruptants, but spore viability was reduced much more than with either sgs1 or spo13 single disruptants. Disruption of the RED1 or RAD17 gene partially alleviated the poorsporulation phenotype of sgs1 disruptants, indicating that portions of the population of sgs1 disruptants are blocked by the meiotic checkpoint. The poor sporulation of sgs1 disruptants was complemented with a mutated SGS1 gene encoding a protein lacking DNA helicase activity; however, the mutated gene could suppress neither the sensitivity of sgs1 disruptants to methyl methanesulfonate and hydroxyurea nor the mitotic hyperrecombination phenotype of sgs1 disruptants.Proteins having DNA helicase activity play important roles in many processes involving DNA, such as replication, repair, and recombination. The product of the Escherichia coli recQ gene, which has DNA helicase activity, is a member of the RecF pathway of recombination. The recF mutants lack conjugal recombination proficiency and UV resistance in the background of recBCD (lacking active endonuclease V) and sbcBC (lacking active exonuclease I), and recQ deletion mutants in the background of recBC sbcBC display UV and methyl methanesulfonate (MMS) sensitivity (22,30).We (38) and Puranam and Blackshear (32) cloned cDNAs encoding a RecQ homologue of human cells, DNA helicase Q1 and RECQL, respectively. Since these are the same gene, we tentatively designated this gene RECQL1. We also cloned a gene of Saccharomyces cerevisiae encoding a protein having DNA helicase motifs with high homology to those of E. coli RecQ and human ATPase RECQL1. This gene soon was found to be identical to the SGS1 (slow growth suppressor 1) gene.A mutant allele of the SGS1 gene was identified as a suppressor of the slow-growth phenotype of top3 mutants (11). Two-hybrid experiments indicated that the yeast Sgs1 protein interacts with DNA topoisomerase III (Top3) (11) as well as DNA topoisomerase II (50). The protein encoded by the SGS1 gene has seven conserved helicase motifs, and Sgs1 was shown to actually have DNA helicase activity (3, 23). Deletion mutants of the SGS1 gene showed a reduction in the fidelity of chromosome segregation during mitosis and meiosis (50, 51); mitotic hyperrecombination phenotypes in interchromosomal homo...

show abstract

Section: Discussionmentioning

confidence: 98%

Sgs1 Helicase Activity Is Required for Mitotic but Apparently Not for Meiotic Functions

Miyajima

Seki

Onoda

et al. 2000

Molecular and Cellular Biology

Self Cite

View full text Add to dashboard Cite

show abstract

“…It has been demonstrated that top3 + is essential for vegetative growth and faithful chromosome segregation in Schizosaccharomyces pombe (Goodwin et al, 1999;Maftahi et al, 1999). In higher eukaryotic cells, two TOP3 homologues have been found, and designated TOP3 α and β (Hanai et al, 1996;Seki et al, 1998aSeki et al, , 1998b. Knockout of the Top3a gene in mice resulted in embryonic lethality, suggesting that Top3 α is essential for cell viability (Li et al, 1998).…”

Section: Introductionmentioning

confidence: 99%

Functional and physical interaction between Sgs1 and Top3 and Sgs1-independent function of Top3 in DNA recombination repair.

Onodera

Seki

et al. 2002

Genes Genet. Syst.

Self Cite

View full text Add to dashboard Cite

A mutant allele of SGS1 of Saccharomyces cerevisiae was identified as a suppressor of the slow-growth phenotype of top3 mutants. We previously reported the involvement of Top3 via the interaction with the N-terminal region of Sgs1 in the complementation of methylmethanesulfonate (MMS) sensitivity and the suppression of hyper recombination of a sgs1 mutant. In this study, we found that several amino acids residues in the N-terminal region of Sgs1 between residues 4 and 33 were responsible for binding to Top3 and essential for complementing the sensitivity to MMS of sgs1 cells. Two-hybrid assays suggested that the region of Top3 responsible for the binding to Sgs1 was bipartite, with portion in the N-and C-terminal domains. Although disruption of the SGS1 gene suppressed the semilethality of the top3 mutant of strain MR, the sgs1-top3 double mutant grew more slowly and was more sensitive to MMS than the sgs1 single mutant, indicating that Top3 plays some role independently of Sgs1. The DNA topoisomerase activity of Top3 was required for the Top3 function to repair DNA damages induced by MMS, as shown by the fact that the TOP3 gene carrying a mutation (Phe for Tyr) at the amino acid residue essential for its activity (residue 356) failed to restore the MMS sensitivity of sgs1-top3 to the level of that of the sgs1 single mutant. Epistatic analysis using the sgs1-top3 double mutant, rad52 mutant and sgs1-top3-rad52 triple mutant indicated that TOP3 belongs to the RAD52 recombinational repair pathway.

show abstract

“…Recently, several companies have developed recombinase-based technologies, such as the Invitrogen Gateway cloning technology, Clontech In-Fusion, BioCat Cold-Fusion, and Red/ET Recombination, but these rely heavily on specialized kits containing vectors, enzymes, or hosts (4,7,10,11,14,15 …”

mentioning

confidence: 99%

Simple Cloning via Direct Transformation of PCR Product (DNA Multimer) to Escherichia coli and Bacillus subtilis

You

Zhang

2012

Appl Environ Microbiol

157

146

View full text Add to dashboard Cite

We developed a general restriction enzyme-free and ligase-free method for subcloning up to three DNA fragments into any location of a plasmid. The DNA multimer generated by prolonged overlap extension PCR was directly transformed in Escherichia coli [e.g., TOP10, DH5␣, JM109, and BL21(DE3)] and Bacillus subtilis for obtaining chimeric plasmids.T he limited choices of restriction enzymes, relatively low efficiencies in digestion and ligation, and possible self-ligation of the digested plasmid may result in difficulties in constructing chimeric plasmids. Recently, several companies have developed recombinase-based technologies, such as the Invitrogen Gateway cloning technology, Clontech In-Fusion, BioCat Cold-Fusion, and Red/ET Recombination, but these rely heavily on specialized kits containing vectors, enzymes, or hosts (4,7,10,11,14,15 Downloaded fromSeveral overlap extension PCR-based methods were developed for subcloning. However, RF cloning (9) and overlap extension PCR cloning (2) require DpnI to digest the vector template. Additionally, the maximum inserted DNA length is ϳ6.7 kb (2). Another technology, called "Quick Assemble," has low positive cloning efficiencies, ϳ33% (16). We developed a sequence-independent "simple cloning" method without the need for restriction and ligation enzymes. The protocol includes three steps ( Fig. 1): (i) linear DNA fragments (i.e., inserted DNA fragment and vector backbone), both of which contained 3= and 5= 40-to 50-bp overlapping termini, are generated by high-fidelity PCR with the New England BioLabs (NEB) Phusion polymerase (Ipswich, MA); (ii) the DNA multimer is generated based on these DNA templates by prolonged overlap extension PCR (POE-PCR) with Phusion polymerase; and (iii) the POE-PCR products (DNA multimer) are transformed into competent Escherichia coli or Bacillus subtilis strains directly, yielding the desired chimeric plasmid. A 1.3-kb insertion fragment (Cherry-cbm17) encoding a cherry fluorescent protein and a family 17 carbohydrate-binding module from Clostridium cellulovorans cellulase 5A (1) was subcloned into a 3.6-kb pET20b vector backbone, yielding a 4.9-kb plasmid, pET20b-cherry-cbm17, where the fusion protein was controlled by a T7 promoter. A linear vector backbone was amplified by using the forward primer VF (5=TAGCCTGGACAA TATCAAATTTACCCTCGAGCACCACCACCACCACCACT3=) and the reverse primer VR (5=TATCCTCCTCGCCCTTGCTCA CCATATGTATATCTCCTTCTTAAAGTTAA3=). VF and VR contain the last 25 bp of the 3= terminus of the insertion sequence (underlined) and the first 25 bp of the 5= terminus of the vector sequence (bold). Similarly, the insertion fragment was amplified by primers IF (5=TTAACTTTAAGAAGGAGATATACATATGG TGAGCAAGGGCGAGGAGGAT3=) and IR (5=AGTGGTGGTG GTGGTGGTGCTCGAGGGTAAATTTGATATTGTCCAGGCT A3=). IF and IR have the reverse complementary sequences of VR and VF, respectively. The standard extension time (SET) in PCR was calculated based on the amplified fragment length divided by 3 kb/min for Phusion polymerase at 72°C. Two linearized DNA fragments were ...

show abstract

Cloning of cDNA Encoding a Novel Mouse DNA Topoisomerase III (Topo IIIβ) Possessing Negatively Supercoiled DNA Relaxing Activity, Whose Message Is Highly Expressed in the Testis

Cited by 46 publications

References 20 publications

Sgs1 Helicase Activity Is Required for Mitotic but Apparently Not for Meiotic Functions

Sgs1 Helicase Activity Is Required for Mitotic but Apparently Not for Meiotic Functions

Functional and physical interaction between Sgs1 and Top3 and Sgs1-independent function of Top3 in DNA recombination repair.

Simple Cloning via Direct Transformation of PCR Product (DNA Multimer) to Escherichia coli and Bacillus subtilis

Contact Info

Product

Resources

About