Comparative study of virulence factors among methicillin resistant Staphylococcus aureus clinical isolates

Abstract

BackgroundMethicillin resistant Staphylococcus aureus (MRSA) is recognized worldwide as a leading cause of hospital and community infections. Biofilm formation by MRSA is an extremely important virulence factor to be understood. Our aim was to establish phenotypic and genotypic characterization of virulence factors among 43 MRSA clinical isolates in a Tunisian hospital.MethodsWe investigated enzymatic profiles, biofilm production and prevalences of genes encoding intracellular adhesion molecules (icaA and icaD), Microbial Surface Components Recognizing Adhesive Matrix Molecules genes (fnbA, fnbB and cna) and exoenzymes genes (geh, sspA and sspB).ResultsOur findings revealed that caseinase, gelatinase, lipase and lecithinase activities were detected in 100%, 100%, 76.6% and 93.3% of cases respectively. This study showed that 23 strains (76.7%) were slime producers on Congo red medium. Furthermore, 46.5% and 53.5% of isolates were respectively highly and moderately biofilm-forming on polystyrene. Significant association was found between both biofilm tests. PCR detection showed that 74.4%, 18.6%, 69.8%, 65.1% and 74.4% of isolates harbored fnbA, fnbB, icaA, icaD and cna genes respectively. In addition, 34.9%, 18.6% and 30.2% of MRSA strains were found positive for sspA, sspB and geh genes respectively. Further, statistical data showed that the presence of the fnbA and fnbB genes was significantly associated with a high biofilm production on polystyrene. However, no statistical association was observed for the icaA, icaD and cna genes.ConclusionsThis study indicates that the detection of fnbA and fnbB contributing to the first step of biofilm formation has been predictable of high biofilm production. As studied factors contribute to MRSA virulence, this research could be of value in orienting towards the development of new preventive and therapeutic measures.

Repurposing Antispasmodic Agent Otilonium Bromide for Treatment of Staphylococcus aureus Infections

“…Bacterial RNA Kit (Omega, United States), cDNA was prepared using TransScript All-in-One First-Strand cDNA Synthesis SuperMix (Transgene, Beijing, China), and qPCR was performed with TransStart Tip Green qPCR SuperMix (Transgene) using a CFX96 Real-Time PCR Detection System (Bio-Rad Laboratories, United Kingdom) (94°Cfor 5 s, 40 cycles of 94°C for 5 s, 58°C for 15 s, and 72°C for 10 s). Primers were used as follows: icaA forward, ACACTTGCTGGCGCAGTCAA; icaA reverse, TCTGGAACCAACATCCAACA; icaD forward, ATGGTCAAGCCCAGACAGAG; and icaD reverse, AGTATTTTCAATGTTTAAAGCAA ( Haddad et al, 2018 ). The primer 16S RNA was used as an internal standard and the experiment was repeated in triplicate.…”

“…All experiments were repeated in triplicate. (Haddad et al, 2018). The primer 16S RNA was used as an internal standard and the experiment was repeated in triplicate.…”

Detection of Heavy Metal Tolerance among different MLSB Resistance Phenotypes of Methicillin-Resistant S. aureus (MRSA)

“…A percentage of 50% was demonstrated in another study as weak biofilm producers followed by moderate and strong biofilm ones by 27% and 23% respectively 41 . Furthermore, higher biofilm formation was also reported at different percentages of 69.8%, 68.3%, and 53.5% 1,5,42 .…”

“…A central role in the regulation of such virulence is controlled by bacterial quorumsensing system 4 . Bacterial biofilm formation ability always allow more advantages for bacterial cell survival compared to planktonic growth, including protection from shear stress, disinfectants, and antibiotics by its special structure [5][6][7] . This mode of bacterial growth induces cellular dormancy associated with multidrug tolerance, and nonheritable phenotype that differs from classic mechanisms of antibiotic resistance 8,9 .…”

Occurrence and antibiogram of <i>Staphylococcus aureus</i> and methicillin-resistant <i>Staphylococcus aureus</i> from table eggs in Nsukka, Enugu State, Nigeria

“…MRSA are isolates of S. aureus which have acquired genes encoding antibiotic resistance to all penicillins, including methicillin. Antibiotic resistance may be an inherent trait of the organism that renders it naturally resistant, or it may be acquired by means of mutation in its' own DNA, or acquisition of resistance-conferring DNA from another source (Haddad et al, 2018). MRSA are resistant to all currently available beta-lactam antibiotics, including penicillins; cephalosporins; carbapenems; and their derivatives (Foster, 2017).…”