Comparison of PCR methods for the detection of genetic variants of carp edema virus

Abstract

The infection of common carp and its ornamental variety, koi, with the carp edema virus (CEV) is often associated with the occurrence of a clinical disease called 'koi sleepy disease'. The disease may lead to high mortality in both koi and common carp populations. To prevent further spread of the infection and the disease, a reliable detection method for this virus is required. However, the high genetic variability of the CEV p4a gene used for PCR-based diagnostics could be a serious obstacle for successful and reliable detection of virus infection in field samples. By analysing 39 field samples from different geographical origins obtained from koi and farmed carp and from all 3 genogroups of CEV, using several recently available PCR protocols, we investigated which of the protocols would allow the detection of CEV from all known genogroups present in samples from Central European carp or koi populations. The comparison of 5 different PCR protocols showed that the PCR assays (both end-point and quantitative) developed in the Centre for Environment, Fisheries and Aquaculture Science exhibited the highest analytical inclusivity and diagnostic sensitivity. Currently, this makes them the most suitable protocols for detecting viruses from all known CEV genogroups.

Carp edema virus from three genogroups is present in common carp in Hungary

“…All three genogroups of CEV were present in Hungarian common carp. As the samples were collected only from common carp, most of fish were infected with virus variants from the CEV genogroup I, which previously had been recorded from common carp (Adamek, Matras, et al., ; Matras et al., ). Virus variants from CEV genogroups IIa and IIb were mostly present in low copy numbers.…”

“…For detection and quantification of CEV p4a DNA, a probe‐based qPCR assay developed by the Centre for Environment, Fisheries and Aquaculture Science (CEFAS) in Weymouth, UK (Adamek, Matras, et al., ; Matras et al., ), was performed using the primers CEFAS_qF: AGTTTTGTAKATTGTAGCATTTCC, CEFAS_qR: GATTCCTCAAGGAGTTDCAGTAAA and the double‐labelled probe [FAM]‐AGAGTTTGTTTCTTGCCATACAAACT‐[BHQ1]. For detection of CyHV‐3 ORF89 DNA, a probe‐based qPCR assay was performed using the primers KHV‐86Fa GACGCCGGAGACCTTGTG and KHV‐163Ra CGGGTTCTTATTTTTGTCCTTGTT and the double‐labelled probe KHV‐109 Pa FAM‐CTTCCTCTGCTCGGCGAGCACG‐BHQ1 (Gilad et al.…”

“…In European carp populations, the disease was related with high morbidity and mortality and was suspected as a cause of the enigmatic spring carp mortality, which for long is observed in several carp breeding areas (Bachmann & Keilholz, ; Way & Stone, ). Diagnosis of a CEV infection relies on the testing of gill tissue for the presence of CEV‐specific DNA sequences by means of PCR (Adamek, Matras, et al., ; Matras et al., ) as an in vitro cultivation of the virus has not been successful (Jung‐Schroers et al., ; Lewisch et al., ). Sequencing of the known DNA fragment encoding the core protein P4a from diseased fish from various locations in Europe and Asia revealed a 6‐10% degree of genetic diversity in this fragment and allowed to recognize up to three different genetic lineages or genogroups (Adamek, Matras, et al., ; Matras et al., ) with viruses from the genogroup I present in farmed carp and CEV from the genogroup IIa mainly present in diseased koi (Adamek, Matras, et al., ; Matras et al., ).…”

Flavobacteria as secondary pathogens in carp suffering from koi sleepy disease

“…Samples collected from freshly killed individuals were prioritized. The samples were collected in Germany and Hungary and had already been used in previous studies (Adamek, Baska, Vincze, & Steinhagen, ; Adamek et al., ; Adamek, Matras et al., ). These included samples from n = 5 CEV‐negative common carp, n = 6 CEV‐positive common carp harbouring from 1 to 10 3 copies of the viral genome per 250 ng of DNA, n = 4 CEV‐positive common carp harbouring from 10 3 to 10 5 copies of the viral genome per 250 ng of DNA and n = 19 CEV‐positive samples harbouring more than 10 5 copies of the viral genome per 250 ng of DNA.…”

“…A dual‐labelled probe‐based quantitative PCR was used for quantifying CEV load in gills as previously described (Adamek, Matras et al., ; Matras et al., ). An SYBR Green‐based quantitative PCR was used for quantifying flavobacteria load in gills as described in Adamek et al.…”