Comparison of polymerase chain reaction and bacteriological culture for the diagnosis of sheep brucellosis using aborted fetus samples

Güler, Leyla; Gündüz, K.; Ok, Ümran

doi:10.1016/s0378-1135(02)00442-x

Cited by 74 publications

(51 citation statements)

References 16 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…According to the findings obtained from the present study, we speculate that an area which is endemic for human brucellosis could have the same particular ecological risk factors for human and favor infection by this agent, since 100% of the isolates from the naturally infected sheep were confirmed as B. melitensis biovar 3. The findings of previous reports, in which B. melitensis biovar 3 is the most common etiological agent of human in Turkey [2,7,9,10,34] and animal brucellosis in Turkey [5,22] and Van region [16,17] support this speculation. Therefore, eradication of brucellosis in human populations can only be achieved by the control of the disease in animals as reported by Buzgan et al [12], and this requires a multidisciplinary approach involving both humans and animals.…”

Section: Discussionsupporting

confidence: 57%

In Vitro Antimicrobial Susceptibility of Brucella melitensis Isolates from Sheep in an Area Endemic for Human Brucellosis in Turkey

2013

View full text Add to dashboard Cite

ABSTRACT. The aim of this study was to assess in vitro antimicrobial susceptibility of Brucella melitensis isolates isolated from naturally infected sheep cases in an area where human brucellosis is endemic, focusing on rifampin (RIF), streptomycin (SM), ciprofloxacin (CPFX), trimethoprim/sulfamethoxazole (TMP/SMZ), gentamicin (GM) and tetracycline (TC) and on 11 other antimicrobials. The identification and typing of Brucella isolates were carried out using standard classification tests and polymerase chain reaction (PCR) methods. Antimicrobial susceptibility testing was carried out on Mueller-Hilton agar. The resistance to SM, CPFX and GM was determined at the rate of 7.3% and to RIF at the rate of 9.7%. The highest (46.3%) resistance was determined against TMP/SMZ. All strains were found to be sensitive to TC at the rate of 100.0%. In conclusion, ovine origin B. melitensis strains evaluated in this study were resistant to at least one antimicrobial (51.2%) that is commonly used in human clinical medicine against brucellosis.

show abstract

Section: Discussionsupporting

confidence: 57%

In Vitro Antimicrobial Susceptibility of Brucella melitensis Isolates from Sheep in an Area Endemic for Human Brucellosis in Turkey

2013

View full text Add to dashboard Cite

show abstract

“…Tel. : (11) 5087-1721 ou (11) (2). In the B19 strain, a fragment of 702 bp (base pairs) of gene ery was deleted and this would be the explanation for its sensitivity to erythritol (7).…”

Section: Introductionmentioning

confidence: 99%

“…However, few studies have been carried out with field samples in a way to use the reaction as a diagnostic tool (11). In Brazil, in spite of the importance of bovine brucellosis, few studies have been performed for the investigation of different Brucella biovars among bovines (15).…”

Section: Introductionmentioning

confidence: 99%

Detection of Brucella abortus DNA in illegal cheese from São Paulo and Minas Gerais and differentiation of B19 vaccinal strain by means of the polymerase chain reaction (PCR)

Miyashiro

Scarcelli

Piatti

et al. 2007

Braz. J. Microbiol.

View full text Add to dashboard Cite

A total of 192 samples of illegal cheese from different regions of the states of São Paulo and Minas Gerais, Brazil, were analyzed for the isolation and detection of Brucella spp. DNA by means of microbiological culture and polymerase chain reaction (PCR), respectively. Samples that yielded positive results were submitted to the analysis of the occurrence of Brucella abortus (biovars 1, 2 e 4), as well as to the differentiation of DNA in B19 vaccinal strain or Brucella abortus field strain using PCR. Although the microorganism was not isolated from any sample, PCR detected 37 positive samples (19.27%) using genus-specific primers. From these, all (100%) were Brucella abortus. Differentiation of the strain showed that 30/37 samples (81.08%) were vaccinal strain B19 and seven (18.92%) were Brucella abortus field strains. Results showed that diagnostic sensitivity of PCR was greater than that of microbiological culture. The standardization of the reaction for the differentiation of vaccinal and field strains enabled the analysis of all samples positive for Brucella abortus. It is, therefore, a reliable method, also applicable to natural infections caused by the microrganism.

show abstract

“…These figures are lower than those 247 previously reported, in which Brucella was detected in 20.86%, 31% and 34.56% of aborted sheep 248 fetuses in Iran, Turkey and Greece, respectively. Of course, our finding is in accordance with 249 these findings who reported B. melitensis strain as a dominant strain in the sheep fetuses 250 (Dehkordi et al 2012;Leyla et al 2003;Samadi et al 2010). Also, E. coli was found in 3 sheep 251 fetuses.…”

supporting

confidence: 91%

“…220 These results are in agreement with another study in which majority of abortions of these parasites 221 occurred in the mentioned animals Masala et al 2007). Our work showed lower (Leyla et al 2003). In our experiments, B. melitensis 243 strains were found in 2 (2.9%) of 70 examined cases from Babolsar (western origin) taken from 244 the herds that was according to serological examination (Rose Bengal and Wright-2ME), showing 245 high titers in this area.…”

mentioning

confidence: 45%

Untitled

Supplemental Information 1: Raw Data

View full text Add to dashboard Cite

In the farming industry, the productivity of livestock herds depends on the fertility efficiency of animals. The accurate diagnosis of a broad range of aetiological agents causing fetal death is often difficult. Our aim was to assess the prevalence rates of Toxoplasma gondii, Neospora caninum, and Brucella spp. infections in ruminant abortion using bacteriological culture and molecular techniques in Mazandaran Province, northern Iran. Samples were collected from 70 aborted sheep, goat, and cattle fetuses between September 2014 and December 2015. Necropsy was performed on all the received samples, and brain tissue and abomasal content were obtained from the aborted fetuses.Protozoan infections were detected by specific polymerase chain reaction (PCR) and bacterial agents using bacteriological examinations and PCR assay.Infectious pathogens were detected in 22 out of 70 (31.4%) examined fetuses. Moreover, T. gondii, N. caninum, and B. melitensis were verified in 13 (18.6%), 4 (5.7%), and 2 (2.85%) samples, respectively. Our results showed that infection with the mentioned pathogenic agents brings about considerable fetal mortality, which can be a major cause of economic loss.The listed pathogens could be considered important etiological agents of fetal loss in Mazandaran Province, for which appropriate control measures such as vaccination and biosecurity can be implemented to prevent infection and reduce reproductive loss in livestock farms. . These parasites belong to the phylum Apicomplexa which are (Bretagne et al. 1993;Yamage et al. 1996). 81Brucella is the most important abortifacient bacterial agent with great economic importance in 82 livestock in many areas of the world. Brucellosis is still a widespread zoonotic disease and some 83 of the species of genus Brucella are pathogenic for human (Leyla et al. 2003 170 TGCCGATCACTTAAGGGCCTTCAT) (18). The PCR amplification was carried out on 1 µl of 171 genomic DNA (prepared freshly by boiling method as described above) with the following steps:172 95 0 C for 5 min as initial denaturation followed by 35 cycles at 95 0 C for 75 sec as denaturation, 177 abortus strain 544 DNA (positive controls) were also included in each reaction. Electrophoresis179 Five microliters of the PCR products were run by electrophoresis through a 1% agarose gel 180 (BioNeer, Korea) stained with Safe stain (0.5 μg/ml-Cina Gen Co, Iran) and visualized using a 181 transilluminator (UVITEC). Statistical analysis183 Statistical analyses were estimated using the chi-square test and were performed with SPSS 184 version 14.0 software (SPSS, Chicago, Illinois). RESULTS186 Findings of our study are summarized in Table 1. A total of 70 samples were collected from 187 animals associated with aborted fetuses from fourteen counties in Mazandaran providence. The 188 great majority of abortions were during the last months of gestation. There were 57 sheep, 4 goats 189 and 9 cattle. 190Protozoal infections were detected by specific PCR in 17 out of 70 (24.3%) examined fetuses 191 ( Fig. 1 and Fig. 2...

show abstract

Comparison of polymerase chain reaction and bacteriological culture for the diagnosis of sheep brucellosis using aborted fetus samples

Cited by 74 publications

References 16 publications

<i>In Vitro</i> Antimicrobial Susceptibility of <i>Brucella melitensis</i> Isolates from Sheep in an Area Endemic for Human Brucellosis in Turkey

<i>In Vitro</i> Antimicrobial Susceptibility of <i>Brucella melitensis</i> Isolates from Sheep in an Area Endemic for Human Brucellosis in Turkey

Detection of Brucella abortus DNA in illegal cheese from São Paulo and Minas Gerais and differentiation of B19 vaccinal strain by means of the polymerase chain reaction (PCR)

Untitled

Contact Info

Product

Resources

About