Comparison of the B- and Z-form hairpin loop structures formed by d(CG)5T4(CG)5

Sk, Wolk; Cc, Hardin; Germann, Markus W.; Jh, van de Sande; Tinoco, Ignacio

doi:10.1021/bi00418a043

Cited by 38 publications

(40 citation statements)

References 44 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The monomer-dimer equilibrium of DNA hairpin structures is shifted to the intramolecular hairpin conformation at low DNA concentrations and high temperature, whereas the addition of salt favors the formation of the intermolecular dimer. Oligonucleotides containing built-in hairpin loops at the center of the sequence have a much lower tendency to give rise to a dimeric form, and as a consequence, hairpin structures predominate even at high strand concentrations (Haasnoot et al, 1980;Patel et al, 1982;Marky et al, 1983;Ikuta et al, 1986;Wolk et al, 1988). The PS oligonucleotide investigated in this study is designed to form …”

Section: Resultsmentioning

confidence: 99%

Characterization of a parallel stranded DNA hairpin

Germann¹,

Vogel²,

Pon³

et al. 1989

Biochemistry

Self Cite

View full text Add to dashboard Cite

Recently we have shown that synthetic DNA containing homooligomeric A-T base pairs can form a parallel-stranded intramolecular hairpin structure [van de Sande et al. (1988) Science (Washington, D.C.) 241, 551-557]. In the present study, we have employed NMR and optical spectroscopy to investigate the structure of the parallel-stranded (PS) DNA hairpin 3'-d(T)8C4(A)8-3' and the related antiparallel (APS) hairpin 5'-d(T)8C4(A)8-3'. The parallel orientation of the strands in the PS oligonucleotide is achieved by introducing a 5'-5' phosphodiester linkage in the hairpin loop. Ultraviolet spectroscopic and fluorescence data of drug binding are consistent with the formation of PS and APS structures, respectively, in these two hairpins. Vacuum circular dichroism measurements in combination with theoretical CD calculations indicate that the PS structure forms a right-handed helix. 31P NMR measurements indicate that the conformation of the phosphodiester backbone of the PS structure is not drastically different from that of the APS control. The presence of slowly exchanging imino protons at 14 ppm and the observation of nuclear Overhauser enhancement between imino protons and the AH-2 protons demonstrate that similar base pairing and base stacking between T and A residues occur in both hairpins. However, the small chemical shift dispersion observed in proton NMR spectra of the PS hairpin suggests that the stem of this hairpin is more regular than that of the APS hairpin. On the basis of NOESY measurements, we find that the orientation of the bases is in the anti region and that the sugar puckering is in the 2'-endo range.(ABSTRACT TRUNCATED AT 250 WORDS)

show abstract

Section: Resultsmentioning

confidence: 99%

Characterization of a parallel stranded DNA hairpin

Germann¹,

Vogel²,

Pon³

et al. 1989

Biochemistry

Self Cite

View full text Add to dashboard Cite

show abstract

“…Comparisons between hairpins in the B-and Z-DNA conformations have been previously reported. It has been found that the d(CGCGCGCGCGTTTTCGCGCGCGCG) hairpin in the B-form shows loop-to-stem connectivities at both sides of the loop (between G10-TI1 and T14-C15), while in the Z-DNA form, in 6 M NaCl04, only the connectivity of the 5'side is seen (14).…”

Section: Discussionmentioning

confidence: 99%

“…Significative contributions to the physico-chemical characterization of hairpin structures have been obtained with studies based on UV-absorption (1,(5)(6)(7)(8), NMR (9)(10)(11)(12)(13)(14)(15)(16)(17), X-ray crystallography (18) and enzymatic digestions (19,20).…”

Section: Introductionmentioning

confidence: 99%

DNA hairpin loops in solution. Correlation between primary structure, thermostability and reactivity with single-strand-specific nuclease from mung bean

et al. 1991

View full text Add to dashboard Cite

Hairpin structures formed by seven DNA inverted repeats have been studied by PAGE, UV(CD)-spectroscopy and nuclease cleavage. The hairpins consisted of (CG)3 stems and loops of 2, 3 and 4 residues. Thermal stabilities (Tm) have been determined in low and high ionic strength buffers, where the hairpins were structured in the B- and Z-DNA form respectively. The thermodynamic parameters of hairpin formation have been obtained by a two-state analysis of the hairpin-coil transitions. It is found that, on increasing the number of bases in the loop from 2 to 3 and 4, the Tms of the B-hairpins decrease, whereas the Tms of the same hairpins in the Z-form increase. This confirms previous evidence (1,2) that in a hairpin molecule the size and structure of the loop are modulated by the conformation of the helical stem. Moreover, B-hairpins with loops comprising 2, 3 and 4 bases have been digested with the single-strand-specific nuclease from mung bean. In our experimental conditions (0 degrees C) the nuclease preferentially cleaves the unbonded nucleotides of the loops. However, the rates of loop hydrolysis, which roughly follow a first-order kinetics, markedly depend on the size of the loop. At a ratio of 3 enzyme units/micrograms DNA, the half-lives of hairpins which are expected to form loops of 4, 3 and 2 residues are 90, 145 and 440 minutes respectively. Thermostability and enzymatic digestion data suggest that two-membered loops can be formed in B-hairpins but not in Z-hairpins.

show abstract

“…79,80 NMR and Xray studies confirmed that the d(T 4 ) nucleotides within such loops are highly organized. [81][82][83][84] Within G-quartet stabilized DNA dimers, d(T 4 ) nucleotides connect diagonally opposed GGGG tracts. The same d(T 4 ) structure, with T-T and T-G base stacking, was observed in several crystal forms 31,85 and in solution Coordinates for the two conformations were obtained from chains C and B of PDB ID 1K8G.…”

Section: T 4 G 4 ) D(g 4 T 4 G 4 ) and D(t 4 G 4 T 4 G 4 )mentioning

confidence: 99%

Thermodynamic Characterization of Binding Oxytricha nova Single Strand Telomere DNA with the Alpha Protein N-terminal Domain

Buczek

Horvath

2006

Journal of Molecular Biology

View full text Add to dashboard Cite

The Oxytricha nova telemere binding protein alpha subunit binds single strand DNA and participates in a nucleoprotein complex that protects the very ends of chromosomes. To understand how the N-terminal, DNA binding domain of alpha interacts with DNA we measured the stoichiometry, enthalpy (DeltaH), entropy (DeltaS), and dissociation constant (K(D-DNA)) for binding telomere DNA fragments at different temperatures and salt concentrations using native gel electrophoresis and isothermal titration calorimetry (ITC). About 85% of the total free energy of binding corresponded with non-electrostatic interactions for all DNAs. Telomere DNA fragments d(T(2)G(4)), d(T(4)G(4)), d(G(3)T(4)G(4)), and d(G(4)T(4)G(4)) each formed monovalent protein complexes. In the case of d(T(4)G(4)T(4)G(4)), which has two tandemly repeated d(TTTTTGGGG) telomere motifs, two binding sites were observed. The high-affinity "A site" has a dissociation constant, K(D-DNA(A)) = 13(+/-4) nM, while the low-affinity "B site" is characterized by K(D-DNA(B)) = 5600(+/-600) nM at 25 degrees C. Nucleotide substitution variants verified that the A site corresponds principally with the 3'-terminal portion of d(T(4)G(4)T(4)G(4)). The relative contributions of entropy (DeltaS) and enthalpy (DeltaH) for binding reactions were DNA length-dependent as was heat capacity (DeltaCp). These trends with respect to DNA length likely reflect structural transitions in the DNA molecule that are coupled with DNA-protein association. Results presented here are important for understanding early intermediates and subsequent stages in the assembly of the full telomere nucleoprotein complex and how binding events can prepare the telomere DNA for extension by telomerase, a critical event in telomere biology.

show abstract

Comparison of the B- and Z-form hairpin loop structures formed by d(CG)5T4(CG)5

Cited by 38 publications

References 44 publications

Characterization of a parallel stranded DNA hairpin

Characterization of a parallel stranded DNA hairpin

DNA hairpin loops in solution. Correlation between primary structure, thermostability and reactivity with single-strand-specific nuclease from mung bean

Thermodynamic Characterization of Binding Oxytricha nova Single Strand Telomere DNA with the Alpha Protein N-terminal Domain

Contact Info

Product

Resources

About