Comparison of Three Alleles at a Major Solid Stem QTL for Wheat Stem Sawfly Resistance and Agronomic Performance in Hexaploid Wheat

Abstract

Solid stems provide resistance to the wheat stem sawfly (WSS, Cephus cinctus Nort.) in wheat (Triticum aestivum L.). A major quantitative trait locus, designated Qss.msub‐3BL, controls most of the variation for stem solidness. Two alleles that differ for temporal expression of stem solidness have been identified. An allele derived from the cultivar ‘Rescue’, designated Qss.msub‐3BL.b, results in solid stems throughout stem development. An allele derived from the cultivar ‘Conan’, designated Qss.msub‐3BL.c, causes high stem solidness early in plant development, but solidness declines as the plant matures. The objective of this study was to develop near‐isogenic lines (NILs) derived from marker‐assisted backcrossing to compare the impact of Qss.msub‐3BL alleles in different genetic backgrounds on stem solidness, WSS resistance, and agronomic traits. The Conan‐derived allele Qss.msub‐3BL.c resulted in lower WSS infestation than the Rescue‐derived allele Qss.msub‐3BL.b in two genetic backgrounds. Both alleles showed a high level of early stem solidness, though this declined as the stem matured for NIL with the Conan‐derived allele. The Conan‐derived allele Qss.msub‐3BL.c resulted in lower WSS infestation and stem cutting than the allele for hollow stems in two genetic backgrounds. Based on yield trials grown over 2 yr, there were no significant differences in grain yield between the NIL pairs. Our results indicate the Conan‐derived allele at Qss.msub‐3BL results in lower infestation of WSS and does not significantly affect agronomic performance, thus providing a novel source of resistance for the development of WSS‐resistant cultivars.

Evaluation of wheat stem sawfly‐resistant solid stem Qss.msub‐3BL alleles in hard red winter wheat

“…Our results indicate that the use of the Conan‐derived allele for WSS resistance in winter wheat was not as effective as the Rescue‐derived Qss.msub‐3BL.b allele. These results contrast with the study of hard red spring wheat where the Conan‐derived allele provided similar levels of WSS resistance as the Rescue‐derived allele (Cook et al., 2019). We believe this is due to a greater number of adult WSS remaining active after the pith produced by the Conan‐derived allele is degraded in winter wheat.…”

“…Temporal expression of the Qss.msub‐3BL.c solid stem phenotype in the Yellowstone NILs was significantly higher than NILs with the hollow stem Qss.msub‐3BL.a allele at early plant development and maturity growth stages (Figure 2). This is similar to what was observed in the hollow stem spring wheat genetic backgrounds (Cook et al., 2019; Varella et al., 2016). Additionally, stem solidness expressed by the Qss.msub‐3BL.c allele significantly declined between early and mature temporal solid stem measurements, which is also what was observed in spring wheat (Cook et al., 2019; Varella et al., 2016).…”

“…As described by Cook et al. (2019), MAB was used to select heterozygous progeny in backcross generations BC 1 , BC 2, and BC 3 using microsatellite marker Xgwm340 , and a Kompetative allele‐specific polymerase chain reaction (KASP) marker, Conan_3B_7 . Microsatellite marker Xgwm340 is diagnostic for all three Qss.msub‐3BL alleles, and the primers are Xgwm340‐F : GCAATCTTTTTTCTGACCACG and Xgwm340‐R : ACGAGGCAAGAACACACATG.…”

Antixenosis, Antibiosis, and Potential Yield Compensatory Response in Barley Cultivars Exposed to Wheat Stem Sawfly (Hymenoptera: Cephidae) Under Field Conditions

“…Therefore, host plant resistance is of critical importance. Although host plant resistance that is due to the presence of solid pith in the stem can be relatively successful for reducing stem cutting in wheat ( Beres et al 2013 , Wu et al 2013 , Talbert et al 2014 , Carcamo et al 2016 , Varella et al 2016 , Adhikari et al 2018 ), solid stems may be compromised by environmental effects on pith expression ( Beres et al 2009 , 2017 ) and relative expression of the trait in different backgrounds ( Cook et al 2019 , Varella et al 2019 , Bainsla et al 2020 ). In addition to stem solidness, other defense-related metabolites, such as DIMBOA (2,4-dihydroxy-7-methoxy-1,4-benzoxazin-3-one), tricetin, and lignin are downregulated in C. cinctus -infested wheat stems when compared with uninfested stems ( Biyiklioglu et al 2018 ).…”

Stability analysis of stem solidness, grain yield, and grain protein concentration in spring wheat

“…The efficacy of WSS resistance is greatly influenced by both genotype (G) and growing environment, and (or) their interactions (GE) (Beres et al 2011). Genetic mapping confirmed that stem-solidness in wheat cultivars is controlled predominantly by the Qss.msub-3BL locus on chromosome 3B introduced from the Portuguese landrace (McNeal et al 1959;Varella et al 2019) and other minor genes located on chromosomes 3A, 3B, 3D, 5A, 5B, and 5D (Larson and MacDonald 1959;Cook et al 2004Cook et al , 2019Houshmand et al 2007;Nilsen et al 2017;Appels et al 2018;Varella et al 2019). The recently released hexaploid wheat reference genome reported a gene called SSt1 (Appels et al 2018), which is responsible for stem solidness controlled by the Qss.msub-3BL.b allele.…”