Congenital afibrinogenemia: Identification and characterization of two novel homozygous fibrinogen Aα and Bβ chain mutations in two Tunisian families

Amri, Yessine; Toumi, N. H.; Fredj, Sondess Hadj; Moerloose, Philippe de

doi:10.1016/j.thromres.2016.04.016

Cited by 8 publications

(4 citation statements)

References 26 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Thus, FGA variants can result in disorders in fibrinogenemia (de Moerloose et al, 2013). For example, homozygous variants can cause afibrinogenemia a serious bleeding disorder (Robert-Ebadi et al, 2009;Amri et al, 2016), so pregnant women with afibrinogenemia are at greater risk of bleeding complications and RPL because of the absence of this key protein (Peyvandi et al, 2011). Heterozygous variants can lead to dysfibrinogenemia or hypofibrinogenemia (Casini et al, 2015), which are often clinically asymptomatic in most patients except in pregnant women who can develop significant bleeding for gynecological reasons (Castaman et al, 2019).…”

Section: Discussionmentioning

confidence: 99%

Exome-Sequencing Identifies Novel Genes Associated with Recurrent Pregnancy Loss in a Chinese Cohort

et al. 2021

View full text Add to dashboard Cite

Recurrent pregnancy loss (RPL) is a common reproductive problem affecting around 5% of couples worldwide. At present, about half of RPL cases remained unexplained. Previous studies have suggested an important role for genetic determinants in the etiology of RPL. Here, we performed whole-exome sequencing (WES) analysis on 100 unrelated Han Chinese women with a history of two or more spontaneous abortions. We identified 6736 rare deleterious nonsynonymous variants across all patients. To focus on possible candidate genes, we generated a list of 95 highly relevant genes that were functionally associated with miscarriage according to human and mouse model studies, and found 35 heterozygous variants of 28 RPL-associated genes in 32 patients. Four genes (FOXA2, FGA, F13A1, and KHDC3L) were identified as being strong candidates. The FOXA2 nonsense variant was for the first time reported here in women with RPL. FOXA2 knockdown in HEK-293T cells significantly diminished the mRNA and protein expression levels of LIF, a pivotal factor for maternal receptivity and blastocyst implantation. The other genes, with 29 variants, were involved in angiogenesis, the immune response and inflammation, cell growth and proliferation, which are functionally important processes for implantation and pregnancy. Our study identified several potential causal genetic variants in women with RPL by WES, highlighting the important role of genes controlling coagulation, confirming the pathogenic role of KHDC3L and identifying FOXA2 as a newly identified causal gene in women with RPL.

show abstract

Section: Discussionmentioning

confidence: 99%

Exome-Sequencing Identifies Novel Genes Associated with Recurrent Pregnancy Loss in a Chinese Cohort

et al. 2021

View full text Add to dashboard Cite

show abstract

“…Genomic DNA was extracted from peripheral leucocytes of the patients and the family members according to the standard procedures of the salt precipitation method. PCR amplification of all exons including the flanking intron regions of fibrinogen genes (FGA, GenBank M64982), (FGB, GenBank M64983) and (FGG, GenBank M10014) was accomplished as described previously . The single deletion causing fibrinogen Mahdia, located in exon 5 of the fibrinogen FGA gene, was amplified using as forward oligonucleotides FGA5bF 5′CCCCAGGAACCCTAGCAGT3′ and as reverse FGA5bR 5′CAGAGGTGACCTTCTCTTTACCA3′ (metabion international AG, Steinkirchen, Germany).…”

Section: Methodsmentioning

confidence: 99%

Fibrinogen Mahdia: A congenitally abnormal fibrinogen characterized by defective fibrin polymerization

et al. 2017

View full text Add to dashboard Cite

show abstract

“…In addition to the homozygous AαR271* mutation, a heterozygous BβS189T mutation was also present in a patient with afibrinogenemia [ 42 ]. The effect of the BβS189T mutation that is not reported by any other work is not discussed as the homozygous AαR271* mutation is sufficient for the induction of afibrinogenemia.…”

Section: Detailed Characterization Of Mutations In the αC-connectormentioning

confidence: 99%

Extension of the Human Fibrinogen Database with Detailed Clinical Information—The αC-Connector Segment

Sovová

Pecankova

Májek

et al. 2021

IJMS

View full text Add to dashboard Cite

Fibrinogen, an abundant plasma glycoprotein, is involved in the final stage of blood coagulation. Decreased fibrinogen levels, which may be caused by mutations, are manifested mainly in bleeding and thrombotic disorders. Clinically relevant mutations of fibrinogen are listed in the Human Fibrinogen Database. For the αC-connector (amino acids Aα240–410, nascent chain numbering), we have extended this database, with detailed descriptions of the clinical manifestations among members of reported families. This includes the specification of bleeding and thrombotic events and results of coagulation assays. Where available, the impact of a mutation on clotting and fibrinolysis is reported. The collected data show that the Human Fibrinogen Database reports considerably fewer missense and synonymous mutations than the general COSMIC and dbSNP databases. Homozygous nonsense or frameshift mutations in the αC-connector are responsible for most clinically relevant symptoms, while heterozygous mutations are often asymptomatic. Symptomatic subjects suffer from bleeding and, less frequently, from thrombotic events. Miscarriages within the first trimester and prolonged wound healing were reported in a few subjects. All mutations inducing thrombotic phenotypes are located at the identical positions within the consensus sequence of the tandem repeats.

show abstract

Congenital afibrinogenemia: Identification and characterization of two novel homozygous fibrinogen Aα and Bβ chain mutations in two Tunisian families

Cited by 8 publications

References 26 publications

Exome-Sequencing Identifies Novel Genes Associated with Recurrent Pregnancy Loss in a Chinese Cohort

Exome-Sequencing Identifies Novel Genes Associated with Recurrent Pregnancy Loss in a Chinese Cohort

Fibrinogen Mahdia: A congenitally abnormal fibrinogen characterized by defective fibrin polymerization

Extension of the Human Fibrinogen Database with Detailed Clinical Information—The αC-Connector Segment

Contact Info

Product

Resources

About