Construction of a rapamycin-susceptible strain of the unicellular red alga <i>Cyanidioschyzon merolae</i> for analysis of the target of rapamycin (TOR) function

The checkpoint kinase TOR (target of rapamycin) regulates expression of a nuclear‐encoded chloroplast RelA‐SpoT homolog (RSH) and modulates chloroplast ribosomal RNA synthesis in a unicellular red alga

“…Here, we wished to determine whether TOR has a broader role in the inhibition of chloroplast and mitochondrial rRNA transcription. Because C. merolae is insensitive to the well‐known TOR inhibitor rapamycin, we constructed a C. merolae strain, SF12, that overexpresses a yeast‐derived FK506‐binding protein (FKBP) to render the cell sensitive to rapamycin (Imamura et al ., ), and used the resultant strain in this study. We previously established a nuclear run‐on assay that can detect de novo rRNA synthesis in the nucleus (Imamura et al ., ).…”

“…The present study indicated that the rRNA syntheses in the three organelles were reduced 24 h after the TOR‐inactivation (Figure ). We recently constructed a human 4EBP1‐expressing strain, SF12‐4EBP1, in which TOR kinase activity can be monitored in vivo , and demonstrated that TOR activity was completely inhibited 6 h after the rapamycin treatment (Imamura et al ., ). This result suggests that the inhibition mechanism of rRNA synthesis after TOR‐inactivation conditions is different between S. cerevisiae and C. merolae .…”

“…DNA fragments approximately 6.6 kbp in size (the part of CmRSH4b containing the ORF, FLAG‐tag, nos terminator, URA5.3 selection marker and CmRSH4b terminator, as ordered from the 5′‐end to the 3′‐end) were amplified using an F1 and R2 primer set and pMKTf‐N082‐Tagging as a template. Resultant DNA fragments were transformed into the SF12 host strain as described previously (Imamura et al ., ). Selected transformants were cultured separately, and PCR analysis was performed using primers F3 (5′‐TTGTAAAACGACGGCCAGTG‐3′) and R1, with genomic DNA from each transformant as a template.…”

“…Cyanidioschyzon merolae 10D wild‐type (WT), SF12 (Imamura et al ., ), TT082‐FLAG, RSH4b_c and RSH4b_ox strains were grown at 40°C under continuous white light (50 μmol m −2 sec −1 ) in liquid MA2 medium (Imamura et al ., ) at pH 2.5 bubbled with air supplemented with 2% CO 2 . For cultivation of SF12, uracil and 5‐fluoroorotic acid were added to MA2 medium (0.5 mg mL −1 final concentration).…”

Accelerated triacylglycerol production without growth inhibition by overexpression of a glycerol-3-phosphate acyltransferase in the unicellular red alga Cyanidioschyzon merolae

“…Because these biological characteristics have been elucidated and various tools have been established for analysis of C. merolae 12 – 14 , this alga is considered a good model organism to understand various molecular functions of photosynthetic eukaryotes, including the fundamental regulation of TAG production. In previous studies, we constructed rapamycin-sensitive C. merolae strains by expressing the Saccharomyces cerevisiae FKBP12 protein in the cells 15 , 16 . Using the resultant strains, we revealed that inactivation of target of rapamycin (TOR), a conserved serine/threonine protein kinase that plays a central role in the regulation of a cell growth and metabolism 17 – 20 , by rapamycin leads to accumulation of LDs and TAGs in the cells.…”