Construction of an ∼2 Mb contig in the region around 80 cM of <i>Arabidopsis thaliana</i> chromosome 2

Wang, Ming Li; Huang, Lu; Bongard-Pierce, Deverie K.; Belmonte, Stephen; Zachgo, Eve Ann; Morris, J. Carrell; Dolan, M. Eileen; Goodman, Howard M.

doi:10.1046/j.1365-313x.1997.00711.x

Cited by 12 publications

(9 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…SSR markers were used for anchoring and comparing the frames of soybean genetic and physical maps (Shultz et al 2007;Shoemaker et al 2008). A physical map of a *2 Mb BAC contig in the region around 80 cM of Arabidopsis thaliana chromosome 2 was constructed using SSR markers and BAC endsequences (Wang et al 1997). Advent of new technologies has not affected the use of microsatellites due to their cost effectiveness and use in large scale genotyping.…”

Section: Rubus Idaeusmentioning

confidence: 99%

Microsatellite markers: an overview of the recent progress in plants

et al. 2010

View full text Add to dashboard Cite

In recent years, molecular markers have been utilized for a variety of applications including examination of genetic relationships between individuals, mapping of useful genes, construction of linkage maps, marker assisted selections and backcrosses, population genetics and phylogenetic studies. Among the available molecular markers, microsatellites or simple sequence repeats (SSRs) which are tandem repeats of one to six nucleotide long DNA motifs, have gained considerable importance in plant genetics and breeding owing to many desirable genetic attributes including hypervariability, multiallelic nature, codominant inheritance, reproducibility, relative abundance, extensive genome coverage including organellar genomes, chromosome specific location and amenability to automation and high throughput genotyping. High degree of allelic variation revealed by microsatellite markers results from variation in number of repeat-motifs at a locus caused by replication slippage and/or unequal crossing-over during meiosis. In spite of limited understanding of the functions of the SSR motifs within the plant genes, SSRs are being widely utilized in plant genome analysis. Microsatellites can be developed directly from genomic DNA libraries or from libraries enriched for specific microsatellites. Alternatively, microsatellites can also be found by searching public databases such as GenBank and EMBL or through cross-species transferability. At present, EST databases are an important source of candidate genes, as these can generate markers directly associated with a trait of interest and may be transferable in close relative genera. A large number of SSR based techniques have been developed and a quantum of literature has accumulated regarding the applicability of SSRs in plant genetics and genomics. In this review we discuss the recent developments (last 4-5 years) made in plant genetics using SSR markers.

show abstract

Section: Rubus Idaeusmentioning

confidence: 99%

Microsatellite markers: an overview of the recent progress in plants

et al. 2010

View full text Add to dashboard Cite

show abstract

“…1). Based on the analysis of 231 F 2 progeny, the pkl-1 mutation mapped to within 1.1 centimorgans of the SSLP marker GPA-1, which had been anchored on the physical map of chromosome 2 (21). Further analysis of the 231 F 2 progeny revealed that the AFLP markers E11M48 and E14M59 (15) flanked pkl-1 and were tightly linked (Fig.…”

Section: ϫ8mentioning

confidence: 99%

PICKLE is a CHD3 chromatin-remodeling factor that regulates the transition from embryonic to vegetative development in Arabidopsis

Ogas

Kaufmann²,

Henderson³

et al. 1999

Proc. Natl. Acad. Sci. U.S.A.

461

387

View full text Add to dashboard Cite

The life cycle of angiosperms is punctuated by a dormant phase that separates embryonic and postembryonic development of the sporophyte. In the pickle (pkl) mutant of Arabidopsis, embryonic traits are expressed after germination. The penetrance of the pkl phenotype is strongly enhanced by inhibitors of gibberellin biosynthesis. Map-based cloning of the PKL locus revealed that it encodes a CHD3 protein. CHD3 proteins have been implicated as chromatin-remodeling factors involved in repression of transcription. PKL is necessary for repression of LEC1, a gene implicated as a critical activator of embryo development. We propose that PKL is a component of a gibberellin-modulated developmental switch that functions during germination to prevent reexpression of the embryonic developmental state.

show abstract

“…For cloning of genomic fragments of the LC-1 line, we developed a new BAC vector based on pBeloBAC11 (Wang et al 1997). The lacZ part of pBeloBAC11 was replaced by a sacB negative selection cassette, which was obtained by PCR (primer ''sacB_for'': TGTGAT CTCATGAACATCAAAAAGTTTGC and primer ''sacB_rev'' TTATGCTCTAGATTATTTGTTAACT GTTAATTG) from vector pIB279 (Blomfield et al 1991).…”

Section: Construction Of Pbelobac-hdmentioning

confidence: 99%

“…Subsequently the DNA solution was concentrated with Microcon concentrators, a Schematic drawing of the pBeloBAC-HD vector. The pBeloBAC-HD vector originates from pBeloBAC11 (Wang et al 1997) but contains several modifications. The loxP site and the EcoRI site in the vector backbone were removed and a modified multiple cloning site containing EcoRI, NotI and I-SceI sites was introduced.…”

Section: Modification Of Bac E11mentioning

confidence: 99%

“…We therefore aimed to isolate the LC-1 locus as a BAC DNA fragment from genomic DNA of the LC-1 line, which required the generation of a complete genomic library from this mouse line. First, an appropriate cloning vector was generated based on pBeloBAC11 (Kim et al 1996;Wang et al 1997), which would not only allow the efficient cloning, but also to modify and remove the genomic insert from the vector backbone. The introduced modifications are described in detail in the Transgenic Res (2011) 20:709-720 713 materials and methods section.…”

Section: Development Of a Suitable Bac Cloning Vectormentioning

confidence: 99%

See 1 more Smart Citation

Development of a BAC vector for integration-independent and tight regulation of transgenes in rodents via the Tet system

et al. 2010

View full text Add to dashboard Cite

The establishment of functional transgenic mouse lines is often limited by problems caused by integration site effects on the expression construct. Similarly, tetracycline (Tet) controlled transcription units most commonly used for conditional transgene expression in mice are strongly influenced by their genomic surrounding. Using bacterial artificial chromosome (BAC) technology in constitutive expression systems, it has been shown that integration site effects resulting in unwanted expression patterns can be largely eliminated. Here we describe a strategy to minimize unfavourable integration effects on conditional expression constructs based on a 75 kb genomic BAC fragment. This fragment was derived from a transgenic mouse line, termed LC-1, which carries the Tet-inducible genes luciferase and cre (Schönig et al. 2002). Animals of this mouse line have previously been shown to exhibit optimal expression properties in terms of tightness in the off state and the absolute level of induction, when mated to appropriate transactivator expressing mice. Here we report the cloning and identification of the transgenic LC-1 integration site which was subsequently inserted into a bacterial artificial chromosome. We demonstrate that this vector facilitates the efficient generation of transgenic mouse and rat lines, where the Tet-controlled expression unit is shielded from perturbations caused by the integration site.

show abstract

Construction of an ∼2 Mb contig in the region around 80 cM of Arabidopsis thaliana chromosome 2

Cited by 12 publications

References 0 publications

Microsatellite markers: an overview of the recent progress in plants

Microsatellite markers: an overview of the recent progress in plants

PICKLE is a CHD3 chromatin-remodeling factor that regulates the transition from embryonic to vegetative development in Arabidopsis

Development of a BAC vector for integration-independent and tight regulation of transgenes in rodents via the Tet system

Contact Info

Product

Resources

About