Construction vascular-specific expression bi-directional promoters in plants

Lv, Xiao-Meng; Song, Xueqin; Rao, Guodong; Pan, Xiang; Guan, Liping; Jiang, Xiangning; Lu, Hai

doi:10.1016/j.jbiotec.2009.03.009

Cited by 14 publications

(12 citation statements)

References 9 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Moreover, the study showed that a cauliflower mosaic virus (CaMV) 35S minimal promoter could be bipolarized not only by fusion with another copy of the 35S minimal promoter in the reverse orientation, but also by fusion with an unrelated minimal promoter ( At SAGmini) derived from a senescence-specific gene. Two reporter genes were expressed successfully in transgenic tobacco using an artificial BD PRO constructed from a 35S mini promoter fused to a natural polar promoter [11, 12]. The BD PROs in the intergenic regions between the cab1 and cab2 , At5g06280 and At5g06290 genes in Arabidopsis thaliana and the Ocpi1 and Ocpi2 genes in rice, and the CaTin1 and CaTin1-2 genes in hot pepper cultivar Bugang have been investigated [13–16].…”

Section: Introductionmentioning

confidence: 99%

Identification and functional characterization of bidirectional gene pairs and their intergenic regions in maize

Liu

Zhou

et al. 2014

BMC Genomics

View full text Add to dashboard Cite

BackgroundBidirectional gene pairs exist as a specific form of gene organization in microorganisms and mammals as well as in model plant species, such as Arabidopsis and rice. Little is known about bidirectional gene pairs in maize, which has a large genome and is one of the most important grain crops.ResultsWe conducted a genome-wide search in maize using genome sequencing results from the inbred line B73. In total, 1696 bidirectional transcript pairs were identified using a modified search model. We functionally characterized the promoter activity of the intergenic regions of most of the bidirectional transcript pairs that were expressed in embryos using a maize embryo transient expression system. A comparative study of bidirectional gene pairs performed for three monocot (Zea mays, Sorghum bicolor and Oryza sativa) and two dicot (Arabidopsis thaliana and Glycine max) plant genomes showed that bidirectional gene pairs were abundant in the five plant species. Orthologous bidirectional gene pairs were clearly distinguishable between the monocot and dicot species although the total numbers of orthologous bidirectional genes were similar. Analysis of the gene pairs using the Blast2GO software suite showed that the molecular functions (MF), cellular components (CC), and biological processes (BP) associated with the bidirectional transcripts were similar among the five plant species.ConclusionsThe evolutionary analysis of the function and structure of orthologous bidirectional gene pairs in various plant species revealed a potential pathway of their origin, which may be required for the evolution of a new species.Electronic supplementary materialThe online version of this article (doi:10.1186/1471-2164-15-338) contains supplementary material, which is available to authorized users.

show abstract

Section: Introductionmentioning

confidence: 99%

Identification and functional characterization of bidirectional gene pairs and their intergenic regions in maize

Liu

Zhou

et al. 2014

BMC Genomics

View full text Add to dashboard Cite

show abstract

“…This strategy was based on the hypothesis that, for many promoters, only the core promoter sequence needs to be oriented with respect to the coding sequence of the gene to ensure transcription in the correct direction, while the upstream promoter elements can be present in either orientation (Peremarti et al 2010). Previously, several studies also employed the same or a similar strategy to produce chimeric bidirectional promoters from unidirectional ones (Barfield and Pua 1991;Xie et al 2001;Li et al 2004;Chaturvedi et al 2006;Lv et al 2009), which provides precedence for the biotechnological application of this hypothesis.…”

Section: Resultsmentioning

confidence: 99%

“…TCGTCCATGCCGAGAGTGAT GFP gene specific primer for RT-PCR and qRT-PCR Qgus1 ATCCGGTCAGTGGCAGTGAAGG GUS gene specific primer for RT-PCR and qRT-PCR Qgus2 CAGCGTAAGGGTAATGCGAG GUS gene specific primer for RT-PCR and qRT-PCR * The added restriction sites are underlined (Zheng et al 2007), pBI121 (for CaMV 35S promoter and NOS-T) (Clontech, USA) and pBIGG (for GFP gene) (kindly provided by Song X; Lv et al 2009) with the following sequence-specific primers: P985-1/ P985-2, 35S1/35S2, NOS1/NOS2 and GFP1/GFP2, respectively (Table 1). The amplified CaMV 35S promoter and the GFP gene were digested with BamHI and joined by ligation with T4 DNA Ligase (Promega, Madison, WI, USA).…”

Section: Vector Constructionmentioning

confidence: 99%

“…In addition to the inducible activity of the selected promoter, it is also desirable to design a regulatory module that would express multigene traits in a coordinately regulated manner (Halpin 2005). One strategy is to modify a unidirectional promoter into a bidirectional one, as shown by several key studies (Barfield and Pua 1991;Xie et al 2001;Li et al 2004;Chaturvedi et al 2006;Lv et al 2009). …”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Bidirectionalization of a methyl jasmonate-inducible plant promoter

et al. 2010

View full text Add to dashboard Cite

A unidirectional promoter can be transformed into a bidirectional module by artificial methods. Here we report the bidirectionalization of the methyl jasmonate (MeJA)-inducible PtDrl02 promoter derived from poplar [(Populus tomentosa × P. bolleana) × P. tomentosa] in planta. Construction of the bidirectional PtDrl02 promoter (designated as mPtDrl02) was rapidly achieved by introducing a minimal 35S promoter in the opposite orientation to the 5' end of PtDrl02. β-Glucuronidase (GUS) and green fluorescent protein (GFP) reporter genes were also interchangeably linked to the 3'-and 5'-ends of mPtDrl02 to produce GFP/mPtDrl02/GUS and GUS/mPtDrl02/GFP vectors, respectively. Using the Agrobacterium-mediated transient expression approach, we demonstrated that the mPtDrl02 module was able to drive gene (GUS and GFP) expression in both orientations simultaneously. Furthermore, the cooperative and concurrent activity from both directions of the mPtDrl02 module was demonstrated following MeJA induction. To our knowledge, this is the first report of an artificial MeJA-responsive bidirectional promoter in perennial plants.

show abstract

“…It activated transcription simultaneously in both directions at comparable levels. Recently, Lv et al (2009) have constructed bidirectional promoters by fusing CaMV35S minimal promoter to 5′ end of either grp1.8 or 4Cl1 promtoer. The regulatory complexities in cis and trans-regulatory mechanisms and technological advances for the development of synthetic promoters have been reviewed by Venter (2007).…”

Section: Inducible Promotersmentioning

confidence: 99%

Plants as bioreactors: Recent developments and emerging opportunities

Sharma

2009

Biotechnology Advances

221

121

View full text Add to dashboard Cite

In recent years, the use of plants as bioreactors has emerged as an exciting area of research and significant advances have created new opportunities. The driving forces behind the rapid growth of plant bioreactors include low production cost, product safety and easy scale up. As the yield and concentration of a product is crucial for commercial viability, several strategies have been developed to boost up protein expression in transgenic plants. Augmenting tissue-specific transcription, elevating transcript stability, tissue-specific targeting, translation optimization and sub-cellular accumulation are some of the strategies employed. Various kinds of products that are currently being produced in plants include vaccine antigens, medical diagnostics proteins, industrial and pharmaceutical proteins, nutritional supplements like minerals, vitamins, carbohydrates and biopolymers. A large number of plant-derived recombinant proteins have reached advanced clinical trials. A few of these products have already been introduced in the market.

show abstract

Construction vascular-specific expression bi-directional promoters in plants

Cited by 14 publications

References 9 publications

Identification and functional characterization of bidirectional gene pairs and their intergenic regions in maize

Identification and functional characterization of bidirectional gene pairs and their intergenic regions in maize

Bidirectionalization of a methyl jasmonate-inducible plant promoter

Plants as bioreactors: Recent developments and emerging opportunities

Contact Info

Product

Resources

About