Contractile roots are the most sensitive organ in Crocus sativus to salt stress

Abstract

Crocus sativus corms were grown in Perlite and watered by half-strength modified Hoagland nutrient solution containing 0, 50, 100, 150, 200 mM NaCl. Growth parameters and contents of proteins, proline, polyphenols, minerals and saccharides were studied in fibrous roots, contractile roots, corms and leaves. All plants remained alive and did not display any sign of foliar damage even at 200 mM NaCl. However, the salinity decreased growth, relative water content and increased contents of proline and Na + in all organs. Total protein content was increased in corms and contractile roots but decreased in fibrous roots. Changes in protein pattern were also observed. Polyphenol content was increased by salinity in all organs except the leaves. As salinity increased, content of soluble saccharides decreased except in the contractile roots.

Comparative proteomic analysis of salt response proteins in seedling roots of two wheat varieties

“…Thus salt stress had a larger effect on CS than Jing-411 as expected since Jing-411 was known to have a higher salt tolerance than CS. Because plant roots are exposed directly to salt conditions, the root is considered to be the first organ directly affected by salinity and the most sensitive organ to salt stress [2]. Due to the ability of plants to activate a large number of stressrelated genes and to synthesize a variety of functional proteins to counteract salt stress [27], it is important to study differences in salt-tolerance mechanisms between tolerant and sensitive varieties by comparative proteome analysis of wheat seedling roots.…”

“…Salinity stress leads to slow growth, wilting or even death of plants, especially in high salt concentrations. Ion toxicity, nutrient constraints, hyperosmotic stress and oxidative stress caused by salt stress may be the primary causes of severely disrupted protein synthesis and act by interfering with normal enzyme activity [2,3]. Under salt stress, plants accumulate ion and reactive oxygen species (ROS) that are harmful to plant cells, especially under high salt concentrations [4].…”

“…Since the root plays important roles in plant positioning, water absorption, and mineral uptake, it is also considered to be the primary site of salinity perception and the main organ responsible for tolerance to salt stress [2]. A comprehensive survey of the root proteome in response to salinity stress will help in understanding salt tolerance in wheat.…”

Efficient Strategies for Elimination of Phenolic Compounds During DNA Extraction from Roots of Pistacia vera L.

“…The amplification potential of the extracted DNA has evaluated using PCR with universal primers including, 18S rDNA universal primers for plant (F:5-GTACAAAGGGCAGGGACGTA-3 and R:5-GGAAGGCTGAGGCAATAACA-3 (Rajaei, Niknam, Seyedi, Ebrahimzadeh, & Razavi, 2009)) and 18SrDNA primers for AM fungi (NS31-GC: 5-GC(2) C(3)G(4)CG(2)C(4)G(3)CG(1)G(3)CG(1)G(4) CACG(1)G(4)TTGGAGGGCAGTCTGGTGCC(1)-3 and Glo1: 5-GCCTGCTTTAAACACTCTA-3 (Liang et al, 2008)). PCR amplifications were performed using Bio-Rad thermal cycler as following; 2 minutes at 94 °C for initial denaturation, 30 cycles with denaturation for 45 seconds at 94 °C, annealing for 45 seconds at 60 °C, and extension for 45 minutes at 72 °C.…”

Salt-induced root protein profile changes in seedlings of maize inbred lines with differing salt tolerances

“…Globally grown under a wide range of climatic conditions, is sensitive to salinity (Maas and Hoffman, 1977). The root is a vital organ for plants functioning in plant positioning and nutrition uptake, and also the first site for salinity sense, responsible for tolerance to salt stress (Rajaei et al, 2009). Investigating of proteomic expression in different salt resistance maize root would give us insights into molecular mechanism in maize salt tolerance.…”