Control of Emi2 activity and stability through Mos-mediated recruitment of PP2A

Wu, Judy Qiju; Hansen, David V.; Guo, Yanxiang; Wang, Michael Zhuo; Tang, Wanli; Freel, Christopher D.; Tung, Jeffrey J.; Jackson, Peter K.; Kornbluth, Sally

doi:10.1073/pnas.0707537104

Cited by 47 publications

(79 citation statements)

References 28 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This slow degradation is triggered by phosphorylation of Emi2 by Cdc2 on four Nterminal sites in Emi2 (Wu et al, 2007a). To determine if these sites might also be relevant to MI Emi2 degradation, we generated 35 S-labeled mutant Em2 in which the four Cdc2 phosphorylation sites had been mutated to alanine.…”

Section: Emi2 Degradation In MI Is Mediated Through Cdk-mediated Phosmentioning

confidence: 99%

“…Mos morpholino (AAGGCATTGCTGTGTGACTCGCTGA) and inverted Mos morpholino (AGTCGCTCAGTGTGTCGTTACGGAA) were purchased from Gene Tools (Philomath, OR). Emi2 morpholino was prepared as previously described (Wu et al, 2007a).…”

Section: Cloning Protein Expression and Mrna Preparationmentioning

confidence: 99%

“…Recombinant GST-Emi2 proteins (aa 489-651 T545/551A, aa 319-375, and aa 319-375 ST335AA) were prepared as previously described (Wu et al, 2007a).…”

Section: Cloning Protein Expression and Mrna Preparationmentioning

confidence: 99%

“…This creates a phosphodegron for the E3 ligase SCF ␤Trcp , leading to proteasomal degradation (Liu and Maller, 2005;Rauh et al, 2005;Hansen et al, 2006). When Emi2 is degraded, the APC is fully acti-vated, releasing eggs from MII into the first embryonic cell cycle (Wu et al, 2007a).…”

Section: Introductionmentioning

confidence: 99%

“…This APC inhibitory activity of Mos is exerted through a known inhibitor of the APC, Emi2, or Erp1. In MII, Mos promotes both the stability and activity of Emi2; the ability of Emi2 to inhibit the APC is regulated through phosphorylation of its C-terminus by Cdc2 and Mos enhances Emi2 function by facilitating its PP2A-mediated dephosphorylation Nishiyama et al, 2007;Wu et al, 2007a). Moreover, Mos helps to maintain steadystate levels of Emi2 by promoting the dephosphorylation of multiple Cdc2 sites on Emi2, which trigger slow degradation of Emi2 when Cdc2/cyclin B kinase levels rise above a certain threshold.…”

Section: Introductionmentioning

confidence: 99%

See 4 more Smart Citations

Cdc2 and Mos Regulate Emi2 Stability to Promote the Meiosis I–Meiosis II Transition

Tang

Guo

et al. 2008

MBoC

Self Cite

View full text Add to dashboard Cite

The transition of oocytes from meiosis I (MI) to meiosis II (MII) requires partial cyclin B degradation to allow MI exit without S phase entry. Rapid reaccumulation of cyclin B allows direct progression into MII, producing a cytostatic factor (CSF)-arrested egg. It has been reported that dampened translation of the anaphase-promoting complex (APC) inhibitor Emi2 at MI allows partial APC activation and MI exit. We have detected active Emi2 translation at MI and show that Emi2 levels in MI are mainly controlled by regulated degradation. Emi2 degradation in MI depends not on Ca2+/calmodulin-dependent protein kinase II (CaMKII), but on Cdc2-mediated phosphorylation of multiple sites within Emi2. As in MII, this phosphorylation is antagonized by Mos-mediated recruitment of PP2A to Emi2. Higher Cdc2 kinase activity in MI than MII allows sufficient Emi2 phosphorylation to destabilize Emi2 in MI. At MI anaphase, APC-mediated degradation of cyclin B decreases Cdc2 activity, enabling Cdc2-mediated Emi2 phosphorylation to be successfully antagonized by Mos-mediated PP2A recruitment. These data suggest a model of APC autoinhibition mediated by stabilization of Emi2; Emi2 proteins accumulate at MI exit and inhibit APC activity sufficiently to prevent complete degradation of cyclin B, allowing MI exit while preventing interphase before MII entry.

show abstract

Section: Emi2 Degradation In MI Is Mediated Through Cdk-mediated Phosmentioning

confidence: 99%

Section: Cloning Protein Expression and Mrna Preparationmentioning

confidence: 99%

“…Recombinant GST-Emi2 proteins (aa 489-651 T545/551A, aa 319-375, and aa 319-375 ST335AA) were prepared as previously described (Wu et al, 2007a).…”

Section: Cloning Protein Expression and Mrna Preparationmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Cdc2 and Mos Regulate Emi2 Stability to Promote the Meiosis I–Meiosis II Transition

Tang

Guo

et al. 2008

MBoC

Self Cite

View full text Add to dashboard Cite

show abstract

Mechanisms Controlling Maintenance and Exit of the CSF Arrest

Lorca

2010

Oogenesis

View full text Add to dashboard Cite

Journey of oocyte from metaphase‐I to metaphase‐II stage in mammals

Sharma

Tiwari

Gupta

et al. 2018

Journal Cellular Physiology

View full text Add to dashboard Cite

In mammals, journey from metaphase-I (M-I) to metaphase-II (M-II) is important since oocyte extrude first polar body (PB-I) and gets converted into haploid gamete. The molecular and cellular changes associated with meiotic cell cycle progression from M-I to M-II stage and extrusion of PB-I remain ill understood. Several factors drive oocyte meiosis from M-I to M-II stage. The mitogen-activated protein kinase3/1 (MAPK3/1), signal molecules and Rho family GTPases act through various pathways to drive cell cycle progression from M-I to M-II stage. The down regulation of MOS/MEK/MAPK3/1 pathway results in the activation of anaphase-promoting complex/cyclosome (APC/C). The active APC/C destabilizes maturation promoting factor (MPF) and induces meiotic resumption. Several signal molecules such as, c-Jun N-terminal kinase (JNK2), SENP3, mitotic kinesin-like protein 2 (MKlp2), regulator of G-protein signaling (RGS2), Epsin2, polo-like kinase 1 (Plk1) are directly or indirectly involved in chromosomal segregation. Rho family GTPase is another enzyme that along with cell division cycle (Cdc42) to form actomyosin contractile ring required for chromosomal segregation. In the presence of origin recognition complex (ORC4), eccentrically localized haploid set of chromosomes trigger cortex differentiation and determine the division site for polar body formation. The actomyosin contractile activity at the site of division plane helps to form cytokinetic furrow that results in the formation and extrusion of PB-I. Indeed, oocyte journey from M-I to M-II stage is coordinated by several factors and pathways that enable oocyte to extrude PB-I. Quality of oocyte directly impact fertilization rate, early embryonic development, and reproductive outcome in mammals.

show abstract

Control of Emi2 activity and stability through Mos-mediated recruitment of PP2A

Cited by 47 publications

References 28 publications

Cdc2 and Mos Regulate Emi2 Stability to Promote the Meiosis I–Meiosis II Transition

Cdc2 and Mos Regulate Emi2 Stability to Promote the Meiosis I–Meiosis II Transition

Mechanisms Controlling Maintenance and Exit of the CSF Arrest

Journey of oocyte from metaphase‐I to metaphase‐II stage in mammals

Contact Info

Product

Resources

About