Creation and screening of a multi-family bacterial oxidoreductase library to discover novel nitroreductases that efficiently activate the bioreductive prodrugs CB1954 and PR-104A

Prosser, Gareth A.; Copp, Janine N.; Mowday, Alexandra M.; Guise, Christopher P.; Syddall, Sophie P.; Williams, Elizabeth; Horvat, Claire N; Swe, Pearl M.; Ashoorzadeh, Amir; Denny, William A.; Smaill, Jeff B.; Patterson, Adam V.; Ackerley, David F.

doi:10.1016/j.bcp.2013.01.029

Cited by 64 publications

(216 citation statements)

References 40 publications

Supporting

Mentioning

199

Contrasting

Order By: Relevance

“…Nitroreductase genes (nfsA, nfsB and azoR from E. coli (nfsA_Ec, nfsB_Ec, and azoR_Ec; Prosser et al 2010a), yfkO from Bacillus subtilis (yfkO_Bs; Prosser et al 2010b) and ycnD from B. subtilis (ycnD_Bs; Prosser et al 2013)) were amplified from previously constructed pUCX::nitroreductase vectors using the gene specific forward primers nfsA_Ec_Fwd (GGCA TATGACGCCAACCATTGAAC), nfsB_Ec_Fwd (GG GCATATGGATATCATTTCTG), azoR_Ec_Fwd (GG GGCATATGAGCAAGGTATTAGTTCTT), yfkO_ Bs_Fwd (GGGGCATATGGCAGATCTAAAGAC-ACA) and ycnD_Bs_Fwd (CCCCCATATGAATGA AGTGATTAAATC) (NdeI sites underlined) and a pUCX specific reverse primer pUCXSacIRv (CCCCGAGCTCAATCATACTCTTCCTTTTTCAAT CCGCCAAAACAGCCAAGC) (SacI site underlined, reverse complement of first two codons of kanamycin resistance gene in bold, and introduced ribosome binding site and linker sequence in italics). For amplification of the chloramphenicol resistance gene chlR a gene specific forward primer Chl_Fwd (GGGGCATATGGAGAAAAAAATCACTGG) (NdeI site underlined) and a gene specific reverse primer Chl_KGRev (based on pUCXSacIRv, above) (CCC GAGCTCAATCATACTCTTCCTTTTTCAATTTAC GCCCCGCCCTGCC) were used.…”

Section: Plasmid Creationmentioning

confidence: 99%

A gain-of-function positive-selection expression plasmid that enables high-efficiency cloning

et al. 2014

Self Cite

View full text Add to dashboard Cite

Directed enzyme evolution is now a routine approach to improve desirable biocatalytic properties. When only a low-throughput screen is available to detect improved variants from a mutant gene library, it is imperative that cloning efficiency be maximized during library synthesis to avoid wasting effort screening empty plasmids. To achieve this we developed pUCXKT, a gain-of-function positive selection expression vector. Insertion of genes amplified using a specialized downstream PCR primer restores key regulatory and genetic elements necessary for co-expression of a kanamycin resistance marker adjacent to the pUCXKT cloning region. We show that pUCXKT enables 100 % cloning efficiency as well as high-level expression of inserted genes. Unlike previous positive selection expression plasmids, the strategy we used to design pUCXKT is readily adaptable to different vector backbones, antibiotic marker genes, and multiple cloning regions.

show abstract

Section: Plasmid Creationmentioning

confidence: 99%

A gain-of-function positive-selection expression plasmid that enables high-efficiency cloning

et al. 2014

Self Cite

View full text Add to dashboard Cite

show abstract

“…13 Applying the 420 nm analysis of NfnB products to the HPLC chromatogram for BC_3024 14 ( Figure 5), the CB1954 reduction products were identified, and it was determined that the 2'-15 hydroxylamine (9.5-11.5 min) was major product. The 4'hydroxylamine (5 min) was the minor 16 product.…”

Section: Enzyme Kineticsmentioning

confidence: 99%

“…YfkO_Bs 3 produces CB1954 hydroxylamine reduction products in a ratio of 75: 25 (4' vs 2'), whilst BC_1619 4 produces them in a ratio of 67: 33. Furthermore, YfkO_Bs also prefers NADPH as cofactor and 5 produces CB1954 kinetic parameters almost identical to that of BC_1619 [13]. It was thus decided to 6 rename BC_1619 as YfkO_Bc [NAD(P)H Nitroreductase from Bacillus cereus].…”

Section: Ydgi_bc 23mentioning

confidence: 99%

“…For the purpose of this work, the BC_1952 protein was not further investigated, but 14 attention shifted to the BC_1619 and BC_3024 proteins. Both of the last mentioned proteins had 15 superior enzyme kinetics to the CB1954 prodrug compared with native NfnB_Ec (Table 2) [13]. The 16 BC_1619 enzyme preferred NADPH and was competitively inhibited by dicoumarol (Figure 7), 17 similarly to the nitroreductase from Enterobacter cloacea [Error!…”

mentioning

confidence: 99%

“…The BC_3024 18 enzyme shared highest identity (69%) to the YdgI enzyme from Bacillus subtilis (YdgI_Bs) using the 19 predicted amino acid sequence (DELTA-BLAST, NCBI database). Similarly to the YdgI_Bs, BC_3024 20 had a preference for NADH and produced more of the 2'-hydroxylamine product compared to the 4'-21 hydroxylamine [13]. It was for this reason that BC_3024 from Bacillus cereus was renamed as 22…”

mentioning

confidence: 99%

See 2 more Smart Citations

Identification of novel nitroreductases from Bacillus cereus and their interaction with the CB1954 prodrug

Gwenin

Poornima

Halliwell

et al. 2015

Biochemical Pharmacology

View full text Add to dashboard Cite

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. Abstract 12Directed enzyme prodrug therapy is a form of cancer chemotherapy in which bacterial prodrug-13 activating enzymes, or their encoding genes, are directed to the tumour before administration of a 14 2 prodrug. The prodrug can then be activated into a toxic drug at the tumour site, reducing off-target 1 effects. The bacterial Nitroreductases are a class of enzymes used in this therapeutic approach and 2 although very promising, the low turnover rate of prodrug by the most studied nitroreductase enzyme, 3NfnB from E. coli (NfnB_Ec), is a major limit to this technology. There is a continual search for 4 enzymes with greater efficiency, and as part of the search for more efficient bacterial nitroreductase 5 enzymes, two novel enzymes from Bacillus cereus (strain ATCC 14579) have been identified and 6shown to reduce the CB1954 (5-(Aziridin-1-yl)-2,4-dinitrobenzamide) prodrug to its respective 2'-and 7 4'-hydroxylamine products. Both enzymes shared features characteristic of the Nitro-FMN-reductase 8Superfamily including non-covalently associated FMN, requirement for the NAD(P)H cofactor, 9 homodimeric, could be inhibited by Dicoumarol (3,3'-methylenebis(4-hydroxy-2H-chromen-2-one), 10 and displayed ping pong bi bi kinetics. Based on the biochemical characteristics and nucleotide 11 alignment with other nitroreductase enzymes, one enzyme was named YdgI_Bc and the other 12YfkO_Bc. Both B. cereus enzymes had greater turnover for the CB1954 prodrug compared with 13 NfnB_Ec, and in the presence of added NADPH cofactor, YfkO_Bc had superior cell killing ability, 14 and produced mainly the 4'-hydroxylamine product at low prodrug concentration. The YfkO_Bc was 15 identified as a promising candidate for future enzyme prodrug therapy. 16

show abstract

Evaluation of two xenobiotic reductases from Pseudomonas putida for their suitability for magnetic nanoparticle‐directed enzyme prodrug therapy as a novel approach to cancer treatment

et al. 2020

View full text Add to dashboard Cite

show abstract

Creation and screening of a multi-family bacterial oxidoreductase library to discover novel nitroreductases that efficiently activate the bioreductive prodrugs CB1954 and PR-104A

Cited by 64 publications

References 40 publications

A gain-of-function positive-selection expression plasmid that enables high-efficiency cloning

A gain-of-function positive-selection expression plasmid that enables high-efficiency cloning

Identification of novel nitroreductases from Bacillus cereus and their interaction with the CB1954 prodrug

Evaluation of two xenobiotic reductases from Pseudomonas putida for their suitability for magnetic nanoparticle‐directed enzyme prodrug therapy as a novel approach to cancer treatment

Contact Info

Product

Resources

About