CRKL plays a pivotal role in tumorigenesis of head and neck squamous cell carcinoma through the regulation of cell adhesion

Yanagi, Hiroko; Wang, Lei; Nishihara, Hiroshi; Kimura, Taichi; Tanino, Mishie; Yanagi, Teruki; Fukuda, Satoshi; Tanaka, Shinya

doi:10.1016/j.bbrc.2011.12.142

Cited by 24 publications

(31 citation statements)

References 26 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Overexpression of Crk and CrkL has been reported in several human cancers, including oral squamous cell carcinoma (5), ovarian carcinoma (6), colon cancer (7), lung cancer (8,9), breast cancer (10,11), gastric cancer (12), and glioblastoma (13,14). Reduced expression of either Crk or CrkL by RNA interference-mediated knockdown lowered the in vivo tumor formation of human ovarian (15), synovial sarcoma (16), glioblastoma (14), breast cancer (10), head and neck squamous cell carcinoma (17), and rhabdomyosarcoma (18) cell lines. Taken together, these reports imply that elevated levels of Crk family proteins promote cell transformation and enhance tumor cell growth (for review see Refs.…”

mentioning

confidence: 99%

Fibroblast Growth Requires CT10 Regulator of Kinase (Crk) and Crk-like (CrkL)

Park

Koptyra

Curran

2016

Journal of Biological Chemistry

View full text Add to dashboard Cite

Edited by Xiao-Fan WangThe chicken tumor virus oncoprotein, v-Crk, induces a substantial increase in protein tyrosine phosphorylation through protein-protein interactions mediated by its SH2 2 and SH3 domains, leading to cell transformation (1). CrkII and Crk-like (CrkL) represent closely related cellular homologues of v-Crk and have similar structures and functions (2). CrkI is a splice variant of CrkII that lacks the C-terminal SH3 domain. Crk family proteins (CrkI, CrkII, and CrkL) interact with many proteins through their SH2 and SH3 domains. Overexpression of Crk family proteins induces transformation of cultured cells (3,4). CrkI is a more potent transforming gene than CrkII and CrkL in part because, like v-Crk, it lacks a C-terminal regulatory phosphorylation site (3). Overexpression of Crk and CrkL has been reported in several human cancers, including oral squamous cell carcinoma (5), ovarian carcinoma (6), colon cancer (7), lung cancer (8, 9), breast cancer (10, 11), gastric cancer (12), and glioblastoma (13,14). Reduced expression of either Crk or CrkL by RNA interference-mediated knockdown lowered the in vivo tumor formation of human ovarian (15), synovial sarcoma (16), glioblastoma (14), breast cancer (10), head and neck squamous cell carcinoma (17), and rhabdomyosarcoma (18) cell lines. Taken together, these reports imply that elevated levels of Crk family proteins promote cell transformation and enhance tumor cell growth (for review see Refs. 19 and 20).To investigate functions of endogenous Crk and CrkL in biological processes at the cellular level, we developed mouse strains and cell lines harboring individual and combined floxed alleles of Crk and CrkL. Application of the Cre-loxP recombination-based conditional knock-out approach to cultured fibroblasts enabled us to demonstrate that endogenous Crk and CrkL are important for maintaining cell structural integrity and proper cell motility (21). We also discovered that Crk and CrkL are required for cell transformation induced by viral oncogenes (22). Here we utilized the conditional knock-out system to examine whether endogenous Crk and CrkL are required for cell growth. Our findings clearly demonstrate that Crk and CrkL play essential, overlapping roles in fibroblast proliferation by enabling cells to progress from the G 1 phase to the S phase. Our study also demonstrates that expression of any one protein among CrkI, CrkII, and CrkL at physiological levels is sufficient to secure cell proliferation. ResultsCrk and CrkL Are Essential for Fibroblast Proliferation-We used the Neon system (Life Technologies) to achieve rapid and efficient gene expression in growing fibroblasts by transduction of synthetic mRNA (synRNA). To reduce innate immune responses and increase ectopic protein expression, we synthesized mRNA using the modified ribonucleotides, pseudo-UTP, and methyl-CTP (23,24). When fibroblasts immortalized by T antigen or the 3T3 protocol were transfected with synthetic green fluorescent protein mRNA (synGFP), both cell types in monolayer cul...

show abstract

mentioning

confidence: 99%

Fibroblast Growth Requires CT10 Regulator of Kinase (Crk) and Crk-like (CrkL)

Park

Koptyra

Curran

2016

Journal of Biological Chemistry

View full text Add to dashboard Cite

show abstract

“…Targeting the gene sequence of CrkL (GenBank: NM_007764) starting at 732, the siRNA sequence GAGAGTACCTTGTGCTTAT was designed as the interference sequence by using Whitehead and SiDirect softwares in accordance of the sequence specificity, thermal dynamic parameters and GC content [19]. An unrelated targeting sequence GTTCTCCGAACGTGTCACGT was also designed as a negative control shRNA (NC-shRNA).…”

Section: Establishment Of Crkl Knockdown Monoclonal Hca-p Cell Linementioning

confidence: 99%

“…CRKL commonly localizes in multiple intracellular compartments mapped at 22q11.21 encoding a protein of 36 kDa [14]. CRKL deregulation is involved in the development and progression of a variety of cancers including gastric cancer (GC), glioblastoma multiforme (GBM), hepatocellular carcinoma (HCC), bladder cancer, lung cancer, colon cancer, ovarian cancer, leukemia, breast cancer, head and neck cancer, rhabdomyosarcoma and neuroblastoma [15][16][17][18][19][20][21][22]. Nevertheless, the role and action mechanism of CRKL in tumor progression are still unclear.…”

Section: Introductionmentioning

confidence: 99%

CRKL knockdown promotes in vitro proliferation, migration and invasion, in vivo tumor malignancy and lymph node metastasis of murine hepatocarcinoma Hca-P cells

Meng

Sun

Guo

et al. 2015

Biomedicine & Pharmacotherapy

View full text Add to dashboard Cite

“…In CRKL-knockdown HSC-3 and HSC-4 cells, cell growth and motility were diminished compared with control cells. The specific adhesions of HSC-3 cells to fibronectin and collagen were also significantly suppressed due to the knockdown of CRKL [60]. Focal adhesion ability was observed decreased for CRKL-knockdown HSC-3 cells by immunofluorescence staining assay.…”

Section: Crkl and Head And Neck Cancermentioning

confidence: 83%

“…Mining the molecular mechanisms in HNSCC pathogenesis and identifying new drug targets is of critical importance [60,61].…”

Section: Crkl and Head And Neck Cancermentioning

confidence: 99%

The Role of CT10 Regulation of Kinase-Like in Cancer

2014

View full text Add to dashboard Cite

V-crk avian sarcoma virus CT10 oncogene homolog-like (CRKL) is a member of CRK family. It acts as an adaptor protein in intracellular signal transduction. CRKL has been reported overexpressed in a variety of cancers affecting the aggressive and malignant behaviors of cancer cells. CRKL seems to show a tumor-promotion role in gastric cancer, glioblastoma multiforme, hepatocellular carcinoma, bladder cancer, lung cancer, colon cancer, ovarian cancer, leukemia, breast cancer, head and neck cancer, rhabdomyosarcoma and neuroblastoma. The association of CRKL with malignant tumors and its potential action mechanisms were summarized. CRKL has the potential to be used as a biomarker for the diagnosis, treatment and prognosis of certain tumors.

show abstract

CRKL plays a pivotal role in tumorigenesis of head and neck squamous cell carcinoma through the regulation of cell adhesion

Cited by 24 publications

References 26 publications

Fibroblast Growth Requires CT10 Regulator of Kinase (Crk) and Crk-like (CrkL)

Fibroblast Growth Requires CT10 Regulator of Kinase (Crk) and Crk-like (CrkL)

CRKL knockdown promotes in vitro proliferation, migration and invasion, in vivo tumor malignancy and lymph node metastasis of murine hepatocarcinoma Hca-P cells

The Role of CT10 Regulation of Kinase-Like in Cancer

Contact Info

Product

Resources

About