Cryopreservation and transplantation of common carp spermatogonia

Franěk, Roman; Marinović, Zoran; Lujić, Jelena; Urbányi, Béla; Fučíková, Michaela; Kašpar, Vojtěch; Pšenička, Martin; Horváth, Ákos

doi:10.1371/journal.pone.0205481

Cited by 40 publications

(16 citation statements)

References 57 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…We can conclude, that previously reported 40-60% transplantation success of testicular [29] and ovarian [30] GSC in common carp is corresponding with numbers of adult germline chimeras producing donor-derived progeny in our study. Therefore, we can retrospectively say, that transplantation success assessed 2-3 months post transplantation probably gives reliable numbers about expected numbers of adult chimeras.…”

Section: Discussionsupporting

confidence: 86%

“…Gold sh (Carassius auratus) broodstock for recipients production originated from the same resource as in our previous studies [29,30]. Gold sh gametes were obtained after hormonal stimulation.…”

Section: Recipient Production and Transplantationmentioning

confidence: 99%

“…Developing embryos at one to four-cell stage were injected with 100 mM solution of antisense dead end morpholino Gene Tools LLC (Philomath, OR, USA) (GenBank accession no. JN578697, target sequence: 5' CATCACAGGTGGACAGCGGCATGGA 3') in 0.2M KCl as described previously [29]. Embryos were cultured until swim-up stage (6 days post fertilization -dpf) in small recirculation system described in Cheng et al (2020) at room temperature (21-22 °C) with UV water treatment.…”

Section: Recipient Production and Transplantationmentioning

confidence: 99%

“…Protocols for cryopreservation of common carp male [29] and female [30] gonadal tissue containing a population of pluripotent GSCs have been developed recently in our laboratory as the rst step towards novel reproductive biotechnologies development in carp.…”

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Production of common carp donor-derived offspring from goldfish surrogate broodstock

Franěk

Kašpar

Gela

et al. 2020

Preprint

Self Cite

View full text Add to dashboard Cite

Background: Common carp is the fourth most-produced species in worldwide aquaculture. Significant efforts are invested in breeding and preservation of genetic integrity of this important species. However, maintaining carp gene bank in situ can be considered as demanding due to its big body size. Recent progress in reproductive biotechnologies in fish allows improving some unfavourable characteristics of a target species using surrogate reproduction. Germ stem cells (gamete precursors) from one species are transplanted into different surrogate species with small body size. After maturation, surrogates are producing donor-derived progeny. Efficient protocols for cryopreservation of carp male and female germ stem cells have been developed lately. Thus, the next logical goal was to assess the potential of goldfish surrogate to produce donor-derived gametes of common carp after intraperitoneal transplantation of testicular cells. Results: High transplantation success was achieved when 44% of the surviving goldfish produced pure donor-derived gametes of common carp. More importantly, both viable eggs and sperm giving rise to pure common carp progeny were produced, witnessing sustainability of the presented method. Donor-derived identity of the offspring was confirmed by genotyping and typical phenotype corresponding to the donor species. Reproductive performance of chimeras was similar to goldfish controls. Assessment of gamete characteristics showed that the size of donor-derived eggs is between control carp and goldfish eggs. Interestingly, flagellum length in donor-derived spermatozoa was comparable to common carp flagellum and significantly shorter than goldfish flagellum. Conclusions: In this study, we succeeded in the production of pure common carp progeny from surrogate goldfish recipients transplanted intraperitoneally by testicular germ cells. Here we reported production of viable eggs between most distant species up to date. Good reproductive performance of goldfish germline chimeras gives a promising prospect for further analysis about the long-term reproductive performance of surrogates, recovery of cryopreserved germ cells or production of monosex stocks. Presented technology is ready to ease needs for carp breeds preservation and their recovery using many times smaller goldfish surrogates.

show abstract

Section: Discussionsupporting

confidence: 86%

Section: Recipient Production and Transplantationmentioning

confidence: 99%

Section: Recipient Production and Transplantationmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Production of common carp donor-derived offspring from goldfish surrogate broodstock

Franěk

Kašpar

Gela

et al. 2020

Preprint

Self Cite

View full text Add to dashboard Cite

show abstract

“…12 . Even though higher cryoprotectant concentrations (2–3 M) are more favorable in cyprinid species such as tench 21 , goldfish 21 and common carp 23 , zebrafish SSCs displayed higher viability at more moderate concentrations (of 1.3 M) similarly to the salmonid species 12,13 . This indicates that species-specific differences in optimal cryopreservation protocols exist, and that protocols need to be optimized for each species.…”

Section: Discussionmentioning

confidence: 99%

Preservation of zebrafish genetic resources through testis cryopreservation and spermatogonia transplantation

Marinović

Lujić

et al. 2019

Sci Rep

Self Cite

View full text Add to dashboard Cite

Zebrafish is one of the most commonly used model organisms in biomedical, developmental and genetic research. The production of several thousands of transgenic lines is leading to difficulties in maintaining valuable genetic resources as cryopreservation protocols for eggs and embryos are not yet developed. In this study, we utilized testis cryopreservation (through both slow-rate freezing and vitrification) and spermatogonia transplantation as effective methods for long-term storage and line reconstitution in zebrafish. During freezing, utilization of 1.3 M of dimethyl sulfoxide (Me2SO) displayed the highest spermatogonia viability (~60%), while sugar and protein supplementation had no effects. Needle-immersed vitrification also yielded high spermatogonia viability rates (~50%). Both optimal slow-rate freezing and vitrification protocols proved to be reproducible in six tested zebrafish lines after displaying viability rates of >50% in all lines. Both fresh and cryopreserved spermatogonia retained their ability to colonize the recipient gonads after intraperitoneal transplantation of vasa::egfp and actb:yfp spermatogonia into wild-type AB recipient larvae. Colonization rate was significantly higher in dnd-morpholino sterilized recipients than in non-sterilized recipients. Lastly, wild-type recipients produced donor-derived sperm and donor-derived offspring through natural spawning. The method demonstrated in this study can be used for long-term storage of valuable zebrafish genetic resources and for reconstitution of whole zebrafish lines which will greatly improve the current preservation practices.

show abstract

Development of an Effective Cryopreservation Protocol for Blue Catfish Oogonia

et al. 2021

View full text Add to dashboard Cite

Long‐term storage of oogonia and germ‐line stem cells provides an alternative to the limitations associated with cryopreserving eggs of important fish species. These cell types are less vulnerable to the stresses of freezing. Cryopreservation has enormous potential for aquaculture advancement, but protocols must be developed for each species and cell type since its success hinges on various input factors. Blue Catfish Ictalurus furcatus were selected as the test species in this study because of the need to improve fry production of Blue Catfish ♂ × Channel Catfish I. punctatus ♀ hybrids, which can be facilitated by storing oogonia in gene banks. Our objective was to develop a freezing protocol for oogonia of this species. We tested different permeating and nonpermeating cryoprotectants, concentrations of these agents, and freezing rates. We proved that all three factors influenced postthaw recovery of oogonia. Of the permeating cryoprotectants, 1.0 M dimethyl sulfoxide resulted in the most live cells with the highest viability percentages, and adding 0.2 M lactose with 10% egg yolk further improved the results. There were also specific interactions in which the effects of concentration and freezing rate varied among the cryoprotectant treatments. The most effective freezing rate was −1.0°C/min, and cell viability was reduced at −2.5°C/min and −5.0°C/min. From these results, we propose adding 1.0 M dimethyl sulfoxide with 0.2 M lactose and 10% egg yolk to cryomedia and freezing it at a rate of −1.0°C/min. By developing a cryopreservation protocol for a commonly cultured catfish, this work may guide the development of protocols for other species of interest.

show abstract

Cryopreservation and transplantation of common carp spermatogonia

Cited by 40 publications

References 57 publications

Production of common carp donor-derived offspring from goldfish surrogate broodstock

Production of common carp donor-derived offspring from goldfish surrogate broodstock

Preservation of zebrafish genetic resources through testis cryopreservation and spermatogonia transplantation

Development of an Effective Cryopreservation Protocol for Blue Catfish Oogonia

Contact Info

Product

Resources

About