Cutting Edge: IFN-γ Produced by Brain-Resident Cells Is Crucial To Control Cerebral Infection with <i>Toxoplasma gondii</i>

Sa, Qila; Ochiai, Eri; Tiwari, Akash; Perkins, Sara; Mullins, Jeremi; Gehman, Marie; Huckle, William R.; Eyestone, W.H.; Saunders, Thomas L.; Shelton, Brent J.; Suzuki, Yasuhiro

doi:10.4049/jimmunol.1500814

Cited by 36 publications

(44 citation statements)

References 16 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Thus, the role of T RM as a source of cytokine production has important functional implications. IFN-γ is required for the protective response to chronic T. gondii infection, serving to activate microglia, astrocytes, and macrophages, to control parasite replication while also playing a role in T cell recruitment (5, 63–65). Overall, the CD103 + population has enhanced the production of critical effector cytokines and indicates that this subset of CD8 + T cell remains activated in the presence of ongoing inflammation unlike other subsets in the infected brain.…”

Section: Discussionmentioning

confidence: 99%

CD103+ CD8 T Cells in the Toxoplasma-Infected Brain Exhibit a Tissue-Resident Memory Transcriptional Profile

et al. 2017

View full text Add to dashboard Cite

During chronic infection, memory T cells acquire a unique phenotype and become dependent on different survival signals than those needed for memory T cells generated during an acute infection. The distinction between the role of effector and memory T cells in an environment of persistent antigen remains unclear. Here, in the context of chronic Toxoplasma gondii infection, we demonstrate that a population of CD8 T cells exhibiting a tissue-resident memory (TRM) phenotype accumulates within the brain. We show that this population is distributed throughout the brain in both parenchymal and extraparenchymal spaces. Furthermore, this population is transcriptionally distinct and exhibits a transcriptional signature consistent with the TRM observed in acute viral infections. Finally, we establish that the CD103+ TRM population has an intrinsic capacity to produce both IFN-γ and TNF-α, cytokines critical for parasite control within the central nervous system (CNS). The contribution of this population to pro-inflammatory cytokine production suggests an important role for TRM in protective and ongoing immune responses in the infected CNS.Accession number: GSE95105

show abstract

Section: Discussionmentioning

confidence: 99%

CD103+ CD8 T Cells in the Toxoplasma-Infected Brain Exhibit a Tissue-Resident Memory Transcriptional Profile

et al. 2017

View full text Add to dashboard Cite

show abstract

“…In agreement with this idea, host proteins UBE2N (72,73) and RNF25 (74), which take part in NF-B pathway, were identified as the ROP18 substrates, indicating that these proteins might be required for ROP18-mediated NF-B signaling regulation. IFN-␥ secretion is crucial for controlling T. gondii infection (75). T. gondii has been reported to down-regulate the expression of IRF1 (76,77), a transcription factor that regulates most of the other half of IFN-␥-responsive genes (78).…”

Section: Discussionmentioning

confidence: 99%

A Human Proteome Array Approach to Identifying Key Host Proteins Targeted by Toxoplasma Kinase ROP18

Yang

Hou

Hao

et al. 2017

Molecular & Cellular Proteomics

View full text Add to dashboard Cite

Toxoplasma kinase ROP18 is a key molecule responsible for the virulence of Toxoplasma gondii; however, the mechanisms by which ROP18 exerts parasite virulence via interaction with host proteins remain limited to a small number of identified substrates. To identify a broader array of ROP18 substrates, we successfully purified bioactive mature ROP18 and used it to probe a human proteome array. Sixty eight new putative host targets were identified. Functional annotation analysis suggested that these proteins have a variety of functions, including metabolic process, kinase activity and phosphorylation, cell growth, apoptosis and cell death, and immunity, indicating a pleiotropic role of ROP18 kinase. Among these proteins, four candidates, p53, p38, UBE2N, and Smad1, were further validated. We demonstrated that ROP18 targets p53, p38, UBE2N, and Smad1 for degradation. Importantly, we demonstrated that ROP18 phosphorylates Smad1 Ser-187 to trigger its proteasome-dependent degradation. Further functional characterization of the substrates of ROP18 may enhance understanding of the pathogenesis of Toxoplasma infection and provide new therapeutic targets. Similar strategies could be used to identify novel host targets for other microbial kinases functioning at the pathogen-host interface. Molecular &

show abstract

“…RNA was purified from a half of each brain, and amounts of mRNA for BAG1, perforin, and granzyme B were measured by reverse transcription real-time PCR using StepOnePlus real-time PCR system with TaqMan reagents (Applied Biosystems, Branchburg, New Jersey) (9, 16). Primers and probe for BAG1 were as follows: TCACGTGGAGACCCAGAGT (Forward), CTGGCAAGTCAGCCAAAATAATCAT (reverse), TTTGCTGTCGAACTCC (probe) (20). Ready-made primers and probes for perforin, granzyme B, and β-actin were from Applied Biosystems.…”

Section: Methodsmentioning

confidence: 99%

Determination of a Key Antigen for Immunological Intervention To Target the Latent Stage of Toxoplasma gondii

Ochiai

Tiwari

et al. 2017

The Journal of Immunology

Self Cite

View full text Add to dashboard Cite

Toxoplasma gondii , an obligate intracellular protozoan parasite, establishes a chronic infection by forming cysts preferentially in the brain, and up to one third of human population worldwide is estimated to be chronically infected with this parasite. However, there are currently no drugs effective against the cyst form of the parasite. In addition, the protective immunity against the cysts remains largely unknown. We analyzed the molecular mechanisms by which the immune system detects host cells harboring the cysts to eliminate the latent stage of the parasite using mice with the H-2d haplotype, which are genetically resistant to the infection. Our study revealed that CD8+ immune T cells bearing T cell receptor Vβ8.1, 8.2 chain have a potent activity to remove T. gondii cysts from the brain. Our studies also uncovered that the H-2Ld is the major antigen-presenting molecule to CD8+ T cells for initiating the cyst elimination, and that the CD8+Vβ8.1, 8.2+ immune T cells recognize the amino-terminal region (amino acids 41 to 152) of dense granule protein 6 (GRA6Nt) of the parasite presented by the H-2Ld molecule. Furthermore, CD8+ immune T cells induced by immunization with recombinant GRA6Nt were eventually capable of removing the cysts from the brain when transferred to infected immunodeficient mice lacking T cells. Thus, GRA6Nt is a novel and potent antigen to activate CD8+ T cells capable of removing T. gondii cysts. These observations offer the basis for immunological intervention to combat the chronic infection with T. gondii by targeting the persistent cysts of the parasite.

show abstract

Cutting Edge: IFN-γ Produced by Brain-Resident Cells Is Crucial To Control Cerebral Infection with Toxoplasma gondii

Cited by 36 publications

References 16 publications

CD103+ CD8 T Cells in the Toxoplasma-Infected Brain Exhibit a Tissue-Resident Memory Transcriptional Profile

CD103+ CD8 T Cells in the Toxoplasma-Infected Brain Exhibit a Tissue-Resident Memory Transcriptional Profile

A Human Proteome Array Approach to Identifying Key Host Proteins Targeted by Toxoplasma Kinase ROP18

Determination of a Key Antigen for Immunological Intervention To Target the Latent Stage of Toxoplasma gondii

Contact Info

Product

Resources

About