CXCL9 Is Important for Recruiting Immune T Cells into the Brain and Inducing an Accumulation of the T Cells to the Areas of Tachyzoite Proliferation to Prevent Reactivation of Chronic Cerebral Infection with Toxoplasma gondii

Abstract

T cells are required to maintain the latency of chronic infection with Toxoplasma gondii in the brain. Here, we examined the role of non-glutamic acid-leucine-arginine CXC chemokine CXCL9 for T-cell recruitment to prevent reactivation of infection with T. gondii. Severe combined immunodeficient (SCID) mice were infected and treated with sulfadiazine to establish a chronic infection. Immune T cells from infected wild-type mice were transferred into the SCID mice in combination with treatment with anti-CXCL9 or control sera. Three days later, sulfadiazine was discontinued to initiate reactivation of infection. Numbers of CD4(+) and CD8(+) T cells isolated from the brains were markedly less in mice treated with anti-CXCL9 serum than in mice treated with control serum at 3 days after sulfadiazine discontinuation. Amounts of tachyzoite (acute stage form of T. gondii)-specific SAG1 mRNA and numbers of foci associated with tachyzoites were significantly greater in the former than the latter at 5 days after sulfadiazine discontinuation. An accumulation of CD3(+) T cells into the areas of tachyzoite growth was significantly less frequent in the SCID mice treated with anti-CXCL9 serum than in mice treated with control serum. These results indicate that CXCL9 is crucial for recruiting immune T cells into the brain and inducing an accumulation of the T cells into the areas where tachyzoites proliferate to prevent reactivation of chronic T. gondii infection.

Age-Associated Resident Memory CD8 T Cells in the Central Nervous System Are Primed To Potentiate Inflammation after Ischemic Brain Injury

“…Moreover, the age-related increase in chemokine receptor expression on circulating CD8 T cells as noted in this study may further enhance this migration. Although speculative, this thinking is premised on several studies in which blocking these particular chemokines (i.e., CCL5, CCL11, CXCL9, and CXCL10) interfered with the normal migration of T cells into the injured CNS (46–55). The cellular source of these chemokines was not assessed in this study, although glial cells are known to be major producers of these signals.…”

Determination of a Key Antigen for Immunological Intervention To Target the Latent Stage of Toxoplasma gondii

“…Mononuclear cells were purified from brains of infected, sulfadiazine-treated SCID mice at 7 days after a systemic transfer of CD8 + immune T cells as described previously (16, 17). To determine TCR Vβ chain usage in the CD8 + immune T cells that had infiltrated into the brains of the recipient SCID mice, the purified mononuclear cells were first pretreated with anti-FcγII/III receptors mAb (clone 2.4G2) and then incubated with a PE-conjugated mAb to CD8α (clone 53–6.7) and FITC-conjugated mAb to various TCR Vβ chains as described previously (18).…”

“…The counting was performed by multiple people in most of the experiments and the average of the counting from the multiple people was used for each mouse. RNA was purified from a half of each brain, and amounts of mRNA for BAG1, perforin, and granzyme B were measured by reverse transcription real-time PCR using StepOnePlus real-time PCR system with TaqMan reagents (Applied Biosystems, Branchburg, New Jersey) (9, 16). Primers and probe for BAG1 were as follows: TCACGTGGAGACCCAGAGT (Forward), CTGGCAAGTCAGCCAAAATAATCAT (reverse), TTTGCTGTCGAACTCC (probe) (20).…”

CD8+ T cells remove cysts of Toxoplasma gondii from the brain mostly by recognizing epitopes commonly expressed by or cross-reactive between type II and type III strains of the parasite

“…The SCID mice were treated with sulfadiazine in the drinking water (400 mg/L) beginning at 9 days after infection for the entire period of experiment to control proliferation of tachyzoites and establish a chronic infection [7,13]. In another experiment, SCID mice were infected intraperitoneally with 1 × 10 4 tachyzoites of the VEG strain (type III) and treated with sulfadiazine beginning at 8 days after infection.…”

“…Numbers of cysts in 5–6 aliquots (20 μl each) of the brain suspensions were counted microscopically. RNA was purified from a half of each brain, and amounts of mRNA for BAG1, perforin, and granzyme B were measured by reverse transcription real-time PCR using StepOnePlus real-time PCR system with TaqMan reagents (Applied Biosystems, Branchburg, New Jersey) [7,13]. Primers and probe for BAG1 were as follows: TCACGTGGAGACCCAGAGT (Forward), CTGGCAAGT-CAGCCAAAATAATCAT (reverse), TTTGCTGTCGAAC TCC (probe) [17].…”