Cycloviruses, gemycircularviruses and other novel replication-associated protein encoding circular viruses in Pacific flying fox (Pteropus tonganus) faeces

Male, Maketalena F.; Kraberger, Simona; Stainton, Daisy; Kami, Viliami; Varsani, Arvind

doi:10.1016/j.meegid.2016.02.009

Cited by 63 publications

(70 citation statements)

References 118 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…1). While the tropism of some CRESS DNA viruses, such as circoviruses (infecting vertebrates) and geminivirus (infecting plants), has been clearly defined, the large majority of such genomes have been characterized using metagenomics from environmental or nonsterile samples, such as feces (13,24,26,35,(62)(63)(64)(65). The tropism of the large majority of CRESS DNA viruses is therefore still unknown (66).…”

Section: Discussionmentioning

confidence: 99%

Case-Control Comparison of Enteric Viromes in Captive Rhesus Macaques with Acute or Idiopathic Chronic Diarrhea

Kapusinszky

Ardeshir

Mulvaney

et al. 2017

J Virol

View full text Add to dashboard Cite

Diarrhea is the major cause of non-research-associated morbidity and mortality affecting the supply of rhesus macaques and, potentially, their responses to experimental treatments. Idiopathic chronic diarrhea (ICD) in rhesus macaques also resembles ulcerative colitis, one form of human inflammatory bowel disease. To test for viral etiologies, we characterized and compared the fecal viromes from 32 healthy animals, 31 animals with acute diarrhea, and 29 animals with ICD. The overall fractions of eukaryotic viral reads were 0.063% for the healthy group, 0.131% for the acute-diarrhea group, and 0.297% for the chronic-diarrhea group. Eukaryotic viruses belonging to 6 viral families, as well as numerous circular Rep-encoding singlestranded DNA (CRESS DNA) viral genomes, were identified. The most commonly detected sequences were from picornaviruses, making up 59 to 88% of all viral reads, followed by 9 to 17% for CRESS DNA virus sequences. The remaining 5 virus families, Adenoviridae, Astroviridae, Anelloviridae, Picobirnaviridae, and Parvoviridae, collectively made up 1 to 3% of the viral reads, except for parvoviruses, which made up 23% of the viral reads in the healthy group. Detected members of the families Picornaviridae and Parvoviridae were highly diverse, consisting of multiple genera, species, and genotypes. Coinfections with members of up to six viral families were detected. Complete and partial viral genomes were assembled and used to measure the number of matching short sequence reads in feces from the 92 animals in the two clinical and the healthy control groups. Several enterovirus genotypes and CRESS DNA genomes were associated with ICD relative to healthy animals. Conversely, higher read numbers from different parvoviruses were associated with healthy animals. Our study reveals a high level of enteric coinfections with diverse viruses in a captive rhesus macaque colony and identifies several viruses positively or negatively associated with ICD.KEYWORDS enterovirus, sapelovirus, parvovirus, CRESS-DNA, idiopathic diarrhea, rhesus macaques, enteric disease etiology W e compared the enteric viromes of captive rhesus macaques (Macaca mulatta) with acute and idiopathic chronic diarrhea (ICD) to those of healthy animals using a case-control study. The genomes of several known and new viruses were characterized using metagenomics. We showed that some specific enterovirus genotypes and some small circular DNA genomes are associated with chronic idiopathic diarrhea, providing candidates for further testing of their pathogenicity. Other viruses, including some parvoviruses, were found at significantly higher levels in healthy animals.

show abstract

Section: Discussionmentioning

confidence: 99%

Case-Control Comparison of Enteric Viromes in Captive Rhesus Macaques with Acute or Idiopathic Chronic Diarrhea

Kapusinszky

Ardeshir

Mulvaney

et al. 2017

J Virol

View full text Add to dashboard Cite

show abstract

“…Although cycloviruses were discovered in stool samples from primates [34], cyclovirus genomes have now been reported from a diversity of specimens including mammals (bats, cats, cows, goats, horses, squirrels, sheep) [18,34,36,38,43,49,73,91,92], birds (chickens) [34,36], and insects (cockroaches and dragonflies) [11,59,70,71] (Table 1). Additionally, a diversity of cyclovirus genomes have been recovered from human samples other than faeces [17,34,80], including cerebrospinal fluid [80], blood serum [76], and respiratory b Fig.…”

Section: Sqacyv-1 Lc018134 Callosciurus Erythraeus Thaiwanensismentioning

confidence: 99%

Revisiting the taxonomy of the family Circoviridae: establishment of the genus Cyclovirus and removal of the genus Gyrovirus

et al. 2017

Self Cite

View full text Add to dashboard Cite

show abstract

“…Sequences sharing >95% identity with sequences in 176 the database were classified to species, whereas sequences with nucleotide identities below this 177 threshold were classified at the genus level. 183 RCA products were digested using a suite of six-cutter FastDigest restriction enzymes (Thermo 341 LfBACM-1 is most similar to a genomic segment from a novel multicomponent CRESS DNA 342 virus discovered in the feces of fruit-eating bats (Male et al 2016). However, the SACM-2 putative 343 capsid protein sequence is most similar to the capsid encoded by a presumably monopartite CRESS 344 DNA virus discovered from a sewage oxidation pond (Kraberger et al 2015).…”

Section: (5'taaacttcagggtgaccaaaaaatca3') (Folmer Et Al 1994) Fiftymentioning

confidence: 99%

“…The high prevalence of CRESS DNA genomes in spiders 289 is even more striking considering that most spiders were processed individually ( 341 LfBACM-1 is most similar to a genomic segment from a novel multicomponent CRESS DNA 342 virus discovered in the feces of fruit-eating bats (Male et al 2016). However, the SACM-2 putative 343 capsid protein sequence is most similar to the capsid encoded by a presumably monopartite CRESS 344 DNA virus discovered from a sewage oxidation pond (Kraberger et al 2015).…”

mentioning

confidence: 99%

Virus discovery in all three major lineages of terrestrial arthropods highlights the diversity of single-stranded DNA viruses associated with invertebrates

Rosario

Mettel

Benner

et al. 2018

Preprint

Self Cite

View full text Add to dashboard Cite

Viruses encoding a replication-associated protein (Rep) within a covalently closed, single-stranded (ss)DNA genome are among the smallest viruses known to infect eukaryotic organisms, including economically valuable agricultural crops and livestock. Although circular Rep-encoding ssDNA (CRESS DNA) viruses are a widespread group for which our knowledge is rapidly expanding, biased sampling towards vertebrates and land plants has limited our understanding of their diversity and evolution. Here we screened terrestrial arthropods for CRESS DNA viruses and report the identification of 44 viral genomes and replicons associated with specimens representing all three major terrestrial arthropod lineages, namely Euchelicerata (spiders), Hexapoda (insects), and Myriapoda (millipedes). We identified virus genomes belonging to three established CRESS DNA viral families (Circoviridae, Genomoviridae, and Smacoviridae); however, over half of the arthropod-associated virus genomes are only distantly related to currently classified CRESS DNA viral sequences. Although members of viral and satellite families known to infect plants (Geminiviridae, Nanoviridae, Alphasatellitidae) were not identified in this study, these plant-infecting CRESS DNA viruses and replicons are transmitted by hemipterans. Therefore, members from six out of the seven established CRESS DNA viral families circulate among arthropods. Furthermore, a phylogenetic analysis of Reps, including endogenous viral sequences, reported to date from a wide array of organisms revealed that most of the known CRESS DNA viral diversity circulates among invertebrates. Our results highlight the vast and unexplored diversity of CRESS DNA viruses among invertebrates and parallel findings from RNA viral discovery efforts in undersampled taxa.

show abstract

Cycloviruses, gemycircularviruses and other novel replication-associated protein encoding circular viruses in Pacific flying fox (Pteropus tonganus) faeces

Cited by 63 publications

References 118 publications

Case-Control Comparison of Enteric Viromes in Captive Rhesus Macaques with Acute or Idiopathic Chronic Diarrhea

Case-Control Comparison of Enteric Viromes in Captive Rhesus Macaques with Acute or Idiopathic Chronic Diarrhea

Revisiting the taxonomy of the family Circoviridae: establishment of the genus Cyclovirus and removal of the genus Gyrovirus

Virus discovery in all three major lineages of terrestrial arthropods highlights the diversity of single-stranded DNA viruses associated with invertebrates

Contact Info

Product

Resources

About