Cytogenetic characterization of the Passiflora edulis Sims × Passiflora cincinnata Mast. interspecific hybrid and its parents

Coelho, Maria do Socorro Evangelista; Bortoleti, Kyria Cilene de Andrade; Araújo, F. P. de; Melo, Natoniel Franklin de

doi:10.1007/s10681-016-1704-4

Cited by 16 publications

(10 citation statements)

References 45 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The chromosomal counts performed in the present work were in agreement with previous reports, confirming the presence of three basic chromosome number: x = 6 for subgenus Decaloba, x = 9 for subgenus Passiflora and x = 10 for subgenus Dysosmia (Sader et al 2019;Coelho et al 2016;Sühsner et al 2016;Melo et al 2015;Bugallo et al 2013;Chiapero et al 2013;Souza et al 2008;Hansen et al 2006;Soares-Scott et al 2005;Muschner et al 2003;Melo & Guerra 2003;Souza et al 2004;Deginani & Escobar 2002;Melo et al 2001;Deginani 2001;Storey 1950).…”

Section: Karyotypic Parameterssupporting

confidence: 92%

See 1 more Smart Citation

Karyotypic analyses and genomic affinity among Argentinean species of Passiflora

et al. 2020

View full text Add to dashboard Cite

The genus Passiflora (Passifloraceae) has more than 500 species, nineteen are native to Argentina. By their austral distribution, these species were included in breeding programs to obtain ornamental varieties tolerant to low temperatures. The aim of this work was to know the cytogenetic characteristics of Passiflora genotypes present in a working collection, as an indispensable knowledge for the development of a breeding plan. Chromosomal preparations were performed and karyotypic characteristics, rDNA sites by FISH and affinity among subgenera by GISH were studied. Chromosome counts in fourteen Argentinean species confirmed the basic chromosome numbers previously published: x = 6 for subgenus Decaloba, x = 9 for subgenus Passiflora and x = 10 for Dysosmia. The karyotypic parameters (karyotype, haploid chromosome length and asymmetry indices) and genomic affinities among the subgenera, clarify most of the chromosomal evolution of the genus. The results obtained strongly suggest that the basic number x = 6 would be the original one and that x = 9 was originated by processes of polyploidy and descendent dysploidy. Since subgenus Passiflora possesses the largest genomes, it is postulated that evolutionary process leading to x = 9 was accompanied by unequal distribution of non-coding repetitive DNA, mainly transposable elements. These processes could explain the asymmetrical karyotypes of species of subgenus Passiflora.

show abstract

Section: Karyotypic Parameterssupporting

confidence: 92%

“…For FISH analysis, rDNA 5S and 18S sequences were isolated and amplified from total genomic DNA of P. edulis f. flavicarpa by polymerase chain reaction (PCR). The 5s primer sequences were designed according to Coelho et al (2016) S: 3' GTGCGATCATACCAGCAGCTTAA TGCACCGG 5'-A: 5' GAGGTGCAACACGAGGACTTCC CAGGAGG 3'.…”

Section: Fish Dna Probesmentioning

confidence: 99%

Karyotypic analyses and genomic affinity among Argentinean species of Passiflora

et al. 2020

View full text Add to dashboard Cite

show abstract

“…Among the interesting characteristics present in some evaluated species are: resistance to foliar diseases (Santos et al 2015, Jesus et al 2016, Freitas et al 2016a) and soil (Freitas et al 2016b) and the presence of self-compatibility which can increase productivity and decrease variation in fruit size among plants in commercial plantations. In addition, interspecific hybrids among the wild species studied have shown ornamental potential (Bugallo et al 2011, Santos et al 2012, 2014, Ocampo et al 2016, Coelho et al 2016. It is interesting to note that although the pollen morphology analysis may be useful in taxonomic studies of the Passiflora genus, it should only be considered an additional tool for species classification to increase our understanding of the systematics of the genus, for re-evaluating the circumscriptions and arrangements of the infrageneric categories currently established, and for better understanding the phylogenetic lineages of the Passiflora.…”

Section: Discussionmentioning

confidence: 99%

Comparative pollen morphological analysis in the subgenera Passiflora and Decaloba

Soares

Jesus

Souza

et al. 2018

An. Acad. Bras. Ciênc.

View full text Add to dashboard Cite

The genus Passiflora is the most diversified of the Passifloraceae, and its palynology presents wide morphological variability. The objective of the study was to evaluate the pollen morphology of 18 Passiflora species in order to identify informative pollinic characteristics to contribute to the taxonomic classification of the genus. The morphology of the pollen grains and the exine structure were investigated using light microscopy and scanning electron microscopy. Differences in the pollen morphology were found in the studied species, mainly in terms of shape, pollen aperture and ornamentation pattern of the exine. Most of the species belonging to the subgenus Passiflora presented ornamented 6-syncolpate pollen grains with an oblate-spheroidal shape and an exine with large lumens. In the subgenus Decaloba the pollen grains were 6-colporate, 12-colpate and 12-colporate, with subprolate to prolate-spheroidal shape, as well as an exine with smaller lumen size and few ornamented. The pollen morphology of the species of the subgenera Passiflora and Decaloba has shown palynological characteristics that have specific diagnostic value, thus allowing a better understanding of the taxonomy of the genus Passiflora.

show abstract

“…Instead, three chromosome subsets were identified: eight chromosomes from P. edulis (completely labeled by the probe), six partially labeled chromosomes, and four unlabeled chromosomes. These results were likely due to the use of a low concentration of blocking DNA, since the partial hybridization of some chromosomes may have occurred because the parental species were phylogenetically related and share significant amounts of DNA sequences [ 38 ]. Conversely, an investigation of F 1 and RC 1 hybrids involving the species P. sublanceolata (Genoma-S) and P. foetida (Genoma-F) was able to identify and confirm hybrid status and visualize chromosomal recombination in RC 1 hybrids and elucidation of triploidy origin in a RC 1 hybrid [ 21 ].…”

Section: Discussionmentioning

confidence: 99%

Identification and characterization of karyotype in Passiflora hybrids using FISH and GISH

et al. 2018

View full text Add to dashboard Cite

BackgroundA great interest exists in the production of hybrid plants of the genus Passiflora given the beauty and exotic features of its flowers which have ornamental value. Hybrid paternity confirmation is therefore important for assuring germplasm origin, and is typically carried out by molecular marker segregation. The aim of this study was to karyotypically characterize the chromosome heritance patterns of the progeny resultant from a cross of P. gardneri and P. gibertii using classical cytogenetics, chromosome banding, and molecular cytogenetics.ResultsAll analyzed genotypes showed the same diploid chromosome number as the genitor species: 2n = 18. Classical and CMA3 and DAPI staining allowed for chromosome counting and satellite identification (secondary constrictions). Fluorescence in situ hybridization (FISH) and genomic in situ hybridization (GISH) were used to characterize subgenomes by either identifying rDNA-specific genome patterns or parental genomes, respectively.ConclusionsThe heritance of chromosomal markers presenting rDNA sites from each parent for genome identification confirmed that all obtained plants were hybrids. These results will improve breeding programs involving the species of this genus. Apart from confirming hybridization, GISH allowed the visualization of recombination between the homeologous chromosome and the introgression of sequences of interest.Electronic supplementary materialThe online version of this article (10.1186/s12863-018-0612-0) contains supplementary material, which is available to authorized users.

show abstract

Cytogenetic characterization of the Passiflora edulis Sims × Passiflora cincinnata Mast. interspecific hybrid and its parents

Cited by 16 publications

References 45 publications

Karyotypic analyses and genomic affinity among Argentinean species of Passiflora

Karyotypic analyses and genomic affinity among Argentinean species of Passiflora

Comparative pollen morphological analysis in the subgenera Passiflora and Decaloba

Identification and characterization of karyotype in Passiflora hybrids using FISH and GISH

Contact Info

Product

Resources

About